Dr. Sr. Shyji PD Principal St. Joseph’s College for Women(A) Gnanapuram, Visakhapatnam
Dear
Esteemed Colleagues,
As
the sun rises on this vibrant gathering, we find ourselves at the crossroads of
discovery—a place where scientific curiosity converges with innovation. Welcome
to the Conference “Recent Advances in Biological Sciences”, where the pulse of
life beats in every discussion, every poster, and every shared insight.
Biology,
the science of life, has seen a plethora of advancements in recent years,
driven by the integration of new technologies and interdisciplinary approaches.
These developments are revolutionizing our understanding of life at the
molecular, cellular, organismal, and ecosystem levels. Some advancements in the
fields of Nanotechnology, Gene editing, Cancer therapy, Tissue Engineering,
Microbiome Research have contributed a lot for our better living. Engineered
microorganisms are being developed to produce biofuels, pharmaceuticals, and
other valuable chemicals more efficiently and sustainably. Synthetic gene
networks can perform complex computations and control cellular behaviour,
opening up new possibilities in Biochemistry and medicine.
I
extend my heartfelt gratitude to the organizers Dr. P. Mary Anupama and Dr. A.
Mousami Sankar for organising this National Conference on Biological Science,
held at St. Joseph’s College for Women (Autonomous). Their tireless efforts and
commitment to advancing scientific knowledge have made this event possible. We
appreciate their vision in creating a platform for researchers, academicians,
and practitioners to share their latest findings and foster collaboration. I
wish this National Conference a great success.
(Principal SJCW)
Dr. K.V. Harish Prashanth, Principal Scientist, Department of Biochemistry, CSIR-Central Food Technological
Research Institute (CSIR-CFTRI), Mysuru
Message
It
gives me immense pleasure to learn that the Department of Biochemistry, St.
Joseph’s College for Women is organising the national conference on the theme
“Advances in Biological Sciences” from 26th to 27th July
2024.
I
would like to congratulate the Organisers for insightful theme symbolising
broader spirit behind innovation and transformation experiencing in the field
culminating Biochemistry inside Biology.
Biology,
the science of life, has seen a plethora of advancements in recent years,
driven by the integration of new technologies and interdisciplinary approaches.
These developments are revolutionizing our understanding of life at the
molecular, cellular, organismal, and ecosystem levels. Some advancements in the
fields of Nanotechnology, Gene editing, Cancer therapy, Tissue Engineering,
Microbiome Research have contributed a lot for our better living. Engineered
microorganisms are being developed to produce biofuels, pharmaceuticals, and
other valuable chemicals more efficiently and sustainably. Synthetic gene
networks can perform complex computations and control cellular behaviour,
opening up new possibilities in Biochemistry and medicine.
I believe this conference will be a good platform for all
the students, researchers, academic faculties, other stakeholders like
industrialists and budding entrepreneurs to discuss the current happening in
the area of Biological Sciences. I wish all the participants of the conference
a fruitful stay and I wish the conference all the success.
22.07.2024 (K.V.
Harish Prashanth)
Prof. V.S.R.K. Prasad Former & Founder Director, IIPE,
Vsp Emeritus Professor, DESAM, AU, Vsp Founder & Life Member, GVP, Vsp Former Chairman, SEAC, AP State. Member of Planning and monitoring
committee, Acharya Nagarjuna University
Biology, the science of
life, has seen a plethora of advancements in recent years, driven by the
integration of new technologies and interdisciplinary approaches. These
developments are revolutionizing our understanding of life at the molecular,
cellular, organismal, and ecosystem levels. Some advancements in the fields of
Nanotechnology, Gene editing, Cancer therapy, Tissue Engineering, Microbiome
Research have contributed a lot for our better living. Engineered
microorganisms are being developed to produce biofuels, pharmaceuticals, and
other valuable chemicals more efficiently and sustainably. Synthetic gene
networks can perform complex computations and control cellular behaviour,
opening up new possibilities in Biochemistry and medicine.
I am happy to know that
St Joseph’s College for Women, Visakhapatnam is organising a two day national
seminar on “Recent Advances In Biological Sciences” on 26th and 27th
July, 2024. I hope that the deliberations will help the faculty and the
participants to update themselves with the recent developments in the field of
Biomedical and Biotechnical advances involving the nano-technology for
practical applications.
I wish the national
seminar a great success and the organisers all the best.
With Best wishes,
VSRK Prasad
Dr P. Mary Anupama Convener and Head Department of Biochemistry St. Joseph’s College for Women(A) Gnanapuram, Visakhapatnam
Advances in biological
sciences refer to significant progress and breakthroughs in understanding life
and living organisms at various levels, from molecular to ecosystem. These
advancements are often driven by new technologies, methodologies, and
interdisciplinary approaches, leading to enhanced knowledge, innovative
applications, and improved solutions to complex biological and environmental
challenges. Biochemistry is one and only subject, that holds immense potential
across various fields due to its comprehensive understanding of the molecular
mechanisms that underlie life processes.
The fields that
Biochemistry spans allow, elucidating the molecular basis of diseases, leading
to the identification of new biomarkers and therapeutic targets. By
understanding individual biochemical variations, treatments can be tailored to
specific patients, improving efficacy and reducing side effects. Advances in
biochemistry have led to the development of biopharmaceuticals, such as
monoclonal antibodies and recombinant proteins. Biochemistry contributes to the
development of genetically modified crops with enhanced traits such as
increased yield, pest resistance, and improved nutritional content. Plant
biochemistry can lead to more sustainable farming practices by improving
fertilizer efficiency, reducing pesticide use, and developing crops that can
thrive in adverse conditions.
The wide varieties of fields that are ventured as a part of
the conference are the allied fields that the subject has contributed to over
the decades. Paper presentations on Agricultural Innovations, Clinical
Sciences, Bioremediation, Ecosystem management, Industrial productions,
Nutrition and health, bioinformatics, Nanoscience’s and Neurosciences.
Hope the Two Day Conference would help the stake holders
enrich their knowledge and continue to make difference in the lives of people.
(Dr P. Mary Anupama)
ABSTRACTS OF GUEST SPEAKERS
Career in
Scientific Research: Curiosity & Challenges
Dr. K.V.
Harish Prashanth,
Department of Biochemistry,
CSIR-Central Food Technological Research Institute,
Mysore
Creating a new economy seems an overwhelming task to
most of us and obviously no one knows how a future sustainable economy will
look like. The role of research in several fields of applied economics, whether
related to business or to the economy as a whole, has greatly increased in
modern times. Research has its special significance in solving
various operational and planning problems of business & industry. Research is
equally important for scientists in studying and seeking answers to various
social problems too including health. Amidst the same, food biotechnology is a
safe and more efficient way to improve crops for overall production and in turn
food Industrial growth. Food biotechnology is the latest
advancement, building on knowledge gained over the last 10,000 years of plant
production. The present talk will be on many areas of food
impacts, including farming and the environment; food quality & processing;
health & nutrition; and influence of the same in developing nations
including India. Further the discussion will be on specific applications which
are currently being researched in these areas at ours institute with
inculcating young minds for desire to get a research career along with its
consequential benefits in intellectual joy of doing some creative work and
service to society. Finally, the challenges in solving the unsolved problems,
i.e. concern over practical problems which initiates research.
Waste
to Energy: Challenges and Prospects
Prof.
VSRK Prasad, Founder & Former Director IIPE
The total quantity of Solid
waste generated in the country is 160038.9 TPD of which 152749.5 TPD of
waste is collected at a collection efficiency of 95.4%. 79956.3 TPD (50 %) of
waste is treated and 29427.2 (18.4%) TPD is landfilled. 50655.4 TPD which is
31.7 % of the total waste generated remains un-accounted.
India produces about 450-500
million tonnes of biomass per year.
The total quantum of biomedical
waste generation was reported as 774 tons/day of biomedical waste out of
which 656 tons/day was non-COVID biomedical waste and 118 tons/day was COVID
biomedical waste.
Open air dumping creates unhygienic and poses enormous
threat to the people. It causes
aesthetic problem and nuisance due to nauseating pungent odor and promotes
spreading of diseases. The situation further gets aggravated by the
indiscriminate disposal of Hospital and clinical wastes. Presence of extremely high level of total and
facial coliform pollutes water bodies.
Carbon dioxide and methane produced from solid waste are extremely
harmful to the environment.
Bioenergy (a
word often used interchangeably with biofuel) is energy derived from biomass,
which are plant- and animal-based materials taken from renewable sources. For
example, dung, grasses, and wood products were early biofuels that
people used to produce energy.
According to government
statistics, total estimated energy generation potential from urban and
industrial organic waste in India is approximately 5,690
MW.
12.33 lakhs tons of bio mass per
day, which can produce 32% of primary energy requirement of the country.
In conclusion, India has tremendous potential for biomass to bioenergy
conversion for the production of reliable, cost-effective, and environmentally
sustainable bioenergy.
Energy by and large is the largest polluting industry
either directly or indirectly irrespective of the sources of energy made use
of.
Hence it is our responsibility to see that the usage of
energy is minimised/optimised in day to day life by each and every citizen,
more so the younger generations, such that the pollution is controlled, and
more so controlling the raising temperatures of the earth.
Green synthesis of AgNPs from leaf
and callus extracts of Hyptis suaveolens L. and
their therapeutic potential
Satyanaryana B, Subhashini Devi P*
*HOD, Department of Biochemistry, AUCST, Andhra University,
Visakhpatnam – 530 003
Hyptis suaveolens (Lamiaceae)
is a medicinally important herb, commonly known as wilayati tulsi, an
indigenous medicinal and aromatic plant. The
plant is known to contain several bioactive compounds such as phenols, tannins,
saponins, alkaloids, steroids and flavonoids etc. It exhibits anti-rheumatic,
anti-cancer, anti-inflammatory, insecticidal and larvicidal activities. Keeping in view of the importance of H. suaveolens, AgNPs were prepared using leaf and callus extracts
as synthesis of silver nanoparticles using plant extracts
as reducing agents is an environmental friendly and cost-effective approach and their antioxidant and anticancer
potentials were evaluated.
Antioxidant potential of L-AgNPs and C-AgNPs were evaluated using Diphenyl Picryl hydrazyl radical
scavenging (DPPH), Ferric Reducing Antioxidant Power (FRAP) and reducing power
assays. The L-AgNPs showed higher antioxidant potential due to large specific
surface area and high fraction of surface atoms and also due to the bioactive
molecules which are absorbed on the active surface of silver nanoparticles when
compare to C-AgNPs.
Anticancer
potential of L-AgNPs and C-AgNPs
were evaluated by
using MTT, adhesion, matrigel invasion, migration assays and terminal
deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay on
MDA-MB 231 cell lines. Generally the tumor cell experience alterations in cell
to cell and cell to ECM adhesion properties and cellular migration which is the
first step in metastasis. Both L- and C-AgNPs treated cells decreased adhesion
and migration of MDA-MB 231 tumor cells. Further studies are required to understand
the molecular mechanisms of L-AgNPs and
C-AgNPs in combating cancer.
TOPIC – Food Science & Nutraceuticals
Leela Rani Alla
Director
–Lee Pharma Ltd
Introduction
Food science and nutraceuticals play a crucial
role in promoting health and well-being. We are what we eat. Food choices
reprogram our metabolism and influence our health. In this seminar, we will
explore the latest research, innovations, and emerging trends in these fields.
Key Topics
Nutraceuticals
& Its Classification:
Nutraceuticals refer to bioactive compounds
derived from food sources, often used as supplements. These include vitamins,
minerals, and herbal extracts. Literature of recent years emphasizes on
redefining the concept of nutraceuticals, taking into consideration the
efficacy, safety and toxicity of these products.
Formulation
& Standardization of Nutraceuticals:
As it ensures individualized care for patients
evidenced based approach is always needed for given intervention and better
patient outcome. Creating a method for standardizing nutraceuticals poses challenges due
to the diverse nature of these products.
Biochemistry
mechanism for nutraceutical formulation for Bone Health: /Therapeutic action of
nutraceutical formulation for Bone Health
Bone health is a delicate balance between bone
modelling and remodelling, which can be disrupted in various diseases.
Imbalance in any of the molecular pathways leads to conditions like
osteoporosis. The use of a novel nutraceutical in blend with non-steroidal
anti-inflammatory drugs (NSAIDs) has been proven a potential candidate for
osteoarthritis, thus improving its efficacy and safety for commercial use.
Quality
assurance and Efficacy
Most of the time
nutraceuticals are available as over the counter products and therefore should
have a strong safety profile and better bioavailability. The most commonly
observed issues are contamination, adulteration (inadvertent or intentional) or
misleading labels.
Themes- 1. Plant, animal and
microbial sciences 2. Bioinformatics,
Environmental Sciences and Nano Sciences 3. Poster Presentations 4. Clinical sciences 4.Food Sciences &
Applied Sciences
Plant, Animal and
Microbial Sciences
Oral presentations at seminar Hall
First session- Stream- Plant, Animal and Microbial Sciences Time 1.30 PM
Session Chair persons- Dr V. Sri Devi (ANITS) and Dr. P. Rupa
Vani (Govt. Degree college, Vijayanagaram)
|
Name of
the Participant |
Designation |
Name of
the Institution |
Place of
the Institute |
|
|
1 |
Dr.P.Sachi Devi |
Associate Professor |
SKR & SKR Government College for
Women(A) |
Kadapa |
|
2 |
Archana Kandala |
Research Scholar |
GITAMS |
Visakhapatnam |
|
3 |
Dr.A.indira Priyadarsini |
Assistant Professor |
GOVERNMENT DEGREE COLLEGE,NAGARI |
NAGARI, CHITTOOR DIST.ANDHRAPRADESH |
|
4 |
Dr.G.Veda Priya |
Associate Professor |
Aditya College of Pharmacy |
Surampalem, East godavari district |
|
5 |
Danda Eswar Harsha Vardhan & Dr L. Sujatha |
UG Student |
Gayatri vidya parishan (MVP campus) |
MVP CAMPUS |
|
6 |
K.Swathi Priya |
Associate Professor |
Srinivasarao college of pharmacy |
Visakhapatnam |
|
7 |
Gudla Naveena & Dr D. Syamala |
UG Student |
Gayatri Vidya Parishad |
Visakhapatnam |
|
8 |
Divya Vani Koraganji |
Research Scholar |
Gandhi Institute of Technology and
Management (GITAM) |
Rushikonda, Visakhapatnam, Andhrapradesh |
|
9 |
Namrata Panda |
UG Student |
St. Joseph's College for Women |
Gnanapuram, Visakhapatnam |
|
10 |
DR.J.NIRMALA |
Assistant Professor |
CSI BISHOP NREWBIGIN COLLEGE OF EDUCATION |
MYALPORE, CHENNAI 4 |
|
11 |
Preethi.M |
UG Student |
St. Joseph's College for Women |
Visakhapatnam |
|
12 |
Gayatri priya & K.
Sarah |
UG Student |
St. Joseph's College for Women |
Visakhapatnam |
|
13 |
ANAPANA GOPAL |
Assistant Professor |
Maharajah's College Autonomous |
VIZIANAGARAM |
|
14 |
RADHA KODITHALA |
Assistant Professor |
MAHARAJAH'S COLLEGE ( AUTONOMOUS),VIANAGARAM
|
VIZIANAGARAM |
|
15 |
Bharati
Mollety |
Assistant
Professor & Head |
Dr
Lankapalli Bullayya College |
Visakhapatnam |
|
16 |
R.
CHRISOLITE.CH |
Research
Scholar |
Andhra
University |
Visakhapatnam |
|
17 |
ANAPANA
GOPAL |
Assistant
Professor |
Maharajah's
College Autonomous |
VIZIANAGARAM
|
|
18 |
Dr.M.Padma
Sundari |
Assistant
Professor |
St.
Joseph's. College for women (A) |
Visakhapatnam |
|
19 |
Varshini Beesetty |
UG Student |
St. Joseph's. College for women (A) |
Visakhapatnam |
|
20 |
Dr. K. Venkata Ratnam |
Assistant Professor |
Rayalaseema University |
Kurnool |
|
21 |
Dr. P. Rosina George |
Assistant Professor |
St. Joseph's College for Women (A),
Gnanapuram |
Visakhapatnam |
|
22 |
Hanumanthu Thanuja & Landa
Urmila |
Student |
St. Joseph's College for Women (A),
Gnanapuram |
Visakhapatnam |
APPLICATION OF AI IN WILDLIFE MONITORING &
CONSERVATION-
A REVIEW
APPLICATION OF AI IN WILDLIFE
MONITORING & CONSERVATION-A REVIEW
Dr. Sachi Devi. P
Lecturer in Zoology, SKR &
SKR Government College for Women (A), Kadapa, A.P., India.
ABSTRACT
Artificial Intelligence (AI) has emerged as a
transformative tool in the field of wildlife monitoring and conservation,
revolutionizing the way we understand, protect, and manage biodiversity. AI
technologies, such as machine learning algorithms and computer vision, are
being increasingly utilized to monitor wildlife populations. These systems can
analyze vast amounts of data from camera traps, acoustic recordings, and
satellite imagery with remarkable accuracy and speed. By automating the
identification and classification of species, AI helps researchers track
population trends, detect illegal activities like poaching, and assess the
health of ecosystems in real-time. Moreover, AI-driven predictive models play a
crucial role in habitat monitoring and conservation planning. By analyzing
environmental data and species behavior patterns, AI can predict habitat
changes, identify conservation hotspots, and optimize resource allocation for
conservation efforts. This proactive approach enables conservationists to prioritize
interventions effectively and mitigate threats before they escalate. In
addition to monitoring and management, AI is advancing our understanding of
complex ecological processes. By integrating data from diverse sources and
generating insights at scales previously unimaginable, AI facilitates
interdisciplinary research and fosters collaboration among scientists,
conservationists, and policymakers worldwide. In conclusion, while AI is not a
panacea for all conservation challenges, its integration into wildlife
monitoring and conservation practices represents a paradigm shift in how we
approach conservation science. By leveraging AI's capabilities, we can make
informed decisions, implement targeted interventions, and secure a sustainable
future for biodiversity on our planet.
Key Words: Artificial
Intelligence, wildlife monitoring and conservation, camera traps, acoustic
recordings, satellite imagery & sustainable future.
MAIL ID :sachidevipureti@gmail.com
Phytochemical screening,
antioxidant, and antifungal activities of Hedysarum tuberosa leaf
extract
Divya Vani Koraganji1, Archana Kandala1, Prameela
Kandra2*
1 Department of Biotechnology,
GITAM School of Science, GITAM Deemed to be University,
Visakhapatnam-530045, divyavanikoraganji@gmail.com,
2*
Department of Biotechnology,
GITAM School of Technology, GITAM Deemed to be University, Visakhapatnam
- 530045, Andhra Pradesh, India. pkandra@gitam.edu,
ABSTRACT
Medicinal plants can be a
potential source of therapeutic compounds that have tremendous applications in
the pharmaceutical industry. Due to the presence of various secondary
metobolites, medicinal plants are used as a source of many potent drugs. This
study aimed to identify the phytochemical compounds and antioxidant and
antifungal activities of Hedysarum tuberosa leaf extract. Phytochemical
screening, total phenolic, and flavonoid contents, antimicrobial and
antioxidant activities were determined using standard methods. The hexane
extract of H.tuberosa showed the total phenolic and flavonoid
contents (8.64 ± 0.77 mg GAE/g and 0.60 ± 0.06 mg QE/g, respectively). The
antioxidant activity against DPPH with IC50 values of 147.89 for H.
tuberosa was observed and showed significant antifungal activity with
zone of inhibition 4.7±1.5mm against A. niger respectively. Hence, the
leaf parts of H .tuberosa provide a potential source for drug discovery.
*Corresponding author
Dr.
K. PRAMEELA, M. Sc., Ph.D
Associate
Professor
Department
of Biotechnology
GITAM
School of Technology, GITAM Deemed to be University
Visakhapatnam
- 530 045
Andhra
Pradesh, India
E-mail:
pkandra@gitam.edu
Tel:
+91-9440311012, 9652672307
Bioprospecting: Unlocking
Nature's Pharmacy
Dr.A.Indira Priyadarsini*
*Lecturer in Botany, Govt.Degree college,Nagari,
Chittoor Dist, Andhra pradesh
ABSTRACT
Bioprospecting,
the systematic exploration of natural sources for bioactive compounds, has
emerged as a pivotal field in the quest for novel therapeutic agents. This
chapter delves into the potential of bioprospecting, highlighting its role in
discovering and developing new drugs from natural resources such as plants,
fungi, marine organisms, and microorganisms. The natural world, with its
immense biodiversity, offers a treasure trove of chemical compounds with unique
structures and biological activities. The chapter explores various
methodologies, from field expeditions and specimen collection to advanced techniques
in chemical analysis and bioassays, showcasing how genomics, metabolomics, and
high-throughput screening have accelerated the discovery process.
Case studies illustrate the
translation of natural compounds into clinically approved drugs, emphasizing
the importance of interdisciplinary collaboration and the integration of
traditional knowledge with modern science. The ethical considerations
surrounding bioprospecting, including biodiversity conservation, intellectual
property rights, and benefit-sharing with source communities, are critically
examined. The chapter also addresses challenges such as the complexity of
natural compound extraction and the need for robust regulatory frameworks. By
fostering sustainable practices, bioprospecting holds the promise of unlocking
new therapeutic avenues and addressing unmet medical needs.
*Corresponding
author mail ID: darshinibharath@gmail.com
Exploring the Biological
potential of Marine Macroalgae
Dr.K.Swathi Priya*, Dr.G.Veda
Priya1
*Associate professor,
Srinivasarao College of Pharmacy
1Associate professor, Aditya College of Pharmacy
ABSTRACT
The present study is to assess
the wound healing property of hyroalcoholic extract of marine macroalgae
selected from the coastal Andhra Pradesh on diabetes induced rats. Where
the extract is firstly assed for anti-diabetic activity when proven it is
associated with diabetic induced wounds. A green macroalgae Spongomorpha
indica was collected from coastal area of Visakhapatnam Andhra Pradesh.
Hydro alcoholic extract was prepared and it was screened for acute toxicity,
anti diabetic. After the antidiabetic activity was confirmed the same extract
was estimated for wound healing in the case of diabetes induced rats.
The wound healing activity of
topical and orally administered hydro alcoholic extracts of spongomorpha indica
was investigated by Dexamethasone delayed wound healing model in rats.
Dexamethasone is a diabetic and immunosuppressed delayed wound healing model.
The spongomorpha indica in Excision wound model showed increased wound
contraction area, epithelization period was increased, scar area was decreased
and significantly showed increased wound healing effect. In incision model
combination of extract plus dexamethasone increased the breaking strength.
Hydroxyproline content increased with treated groups compared to Dexamethasone
group. Hence the results suggest that hydro alcoholic extracts of Spongomorpha
indica showed fast healing effect in infectious wound, immune suppressed and
diseased conditions like diabetes.
KEYWORDS:
Anti diabetic, Streptozocin, Dexamethasone, Glibenclamide, Spongomorpha indica,
Wound healing, Hyrdroxypyroline, epithelization.
Cytotoxic activity of Methanol
extract of Chrysanthemum on MCF 7 Cell line
Dr. L. Sujatha1,
Dr. D. Syamala2,D. Eswar Harsha Vardhan3,4.
L. Sarath4
1. HOD & Assistant Professor, Department of
Microbiology, GVP college for degree and PG courses (A), MVP campus,
vskp.
- Assistant Professor, Department of
Microbiology, GVP college for degree and PG courses (A), MVP campus,
Visakhapatnam.
3. & 4. (Student,
Department of Microbiology), GVP college for degree and PG courses (A) MVP
campus, Visakhapatnam
ABSTRACT
Chrysanthemum is one of the most widely popular
flowers around the world. It is quite widely used for its medicinal properties
and antioxidant properties. Chrysanthemum species have been around from the
past few thousands of years. It was first originated in China and later spread
across the world. It is also widely popular as an ornamental flower.The main
aim of the project is to estimate the presence of these chemical compounds in
the floral sample and to try to apply these compounds in our daily life for the
betterment of our overall health.The plant was air dried and made into a fine
powder form and various phytochemical tests are performed, it is estimated that
the sample contain carbohydrates, coumarins, flavonoids, tannin and
terpenoids. And other compounds like glycosides, phenols, proteins,
saponins, steroids are absent. The crude extract showed increasing antioxidant
activity with increasing concentration. It was, however, observed that sample
possesses total antioxidant capacity equivalent to 35.61 mg/g ascorbic acid at
higher concentration (100 µg/mL). The DPPH assay of the sample shows that
antioxidant activity of Sample was observed to be highest activity at 500mg/ml,
i.e. 84.24%.Compared to the values published by previous scientists our values
are observed to be comparatively higher, it maybe due to plant sample used or
the experimentation methods followed. The MTT assay results suggest that the
given test sample showed cytotoxic as well as anti-cancer in nature on human
breast cancer cells with the low IC50 value of 46.92ug/ml.Due to its
rich antioxidants, anti-cancer and other medicinal properties chrysanthemum has
wide culinary and medical applications.Future studies should dwelve deeper into
the specific bioactive compounds responsible for chrysanthemum's antioxidant
effects and explore its potential applications in functional foods,
supplements, or herbal formulations and its applications as an organic
fertilizer aimed at enhancing human health.
Email:
lsujatha@gvpcdpgc.edu.in
Preliminary Phytochemical
Screening and HPTLC studies on Cycas revoluta
Dr.G.Veda
Priya* and Dr.K.Swathi Priya1
*Aditya
College of Pharmacy,
1 Srinivasarao College of
Pharmacy,Andhra Pradesh-530003.
ABSTRACT
The use of
herbal medicinal products and supplements has increased tremendously over the
past three decades with not less than 80% of people worldwide relying on them
for some part of primary healthcare.However with respect to their active compounds and
therapeutic value many medicinal plants from various environments fall under
the category of being under explored. In recent years, there has been great demand for
plant derived products in developed countries. These products are
increasingly being sought out as medicinal products, nutraceuticals and
cosmetics. The present study was carried out to evaluate the phytochemical
properties and formulation of traditional medicinal plant Cycas
revoluta belonging to the family Cycadaceae.The histology of the
leaf is performed by taking a transverse section which showed the presence of
epidermis, spongy parenchyma, phloem and xylem. The dry powder of the leaves
are subjected to fluroscence analysis using UV chamber for the detection of
various phytoconstituents.The ethanolic extract of the leaves showed the
presence of alkaloids and flavanoids. . HPTLC CAMAG
technique is used to detect type of compounds under different chromatographic
conditions at 366 nm. Four fluorescent bands were observed at a Rf value
of 0.43, 0.47,0.51, 0.74 and the compounds are estimated to be flavanoids or
phenolic compounds.Herbal ointment was prepared by mixing accurately measured
ethanolic extract of Cycas revoluta to the ointment base by levigating
method to prepare a smooth paste with two or three times its weight of
base, gradually incorporating more base until to form homogeneous ointment. The
formulated ointment was evaluated by using the parameters like: Physical
examination, consistency, solubility, spreadability, irritant effect, PH etc.
Finally, the ointment is filled in tubes and was stored at room temperature.
Further studies on isolation of compounds and proven biological
activities from these plants will give us a scope which is useful to mankind.
Email: gummadi.veda88@gmail.com
ANTICANCER ACTIVITY OF METHANOLIC EXTRACTS OF ROSE
FLOWER
L.
Sujatha1, D.
Syamala2, G.
Naveena3 and G.
Gayathri4
1. HOD & Assistant Professor, Department of
Microbiology, GVP college for degree and PG courses (A), MVP campus,
Visakhapatnam.
2. Assistant Professor, Department of Microbiology,
GVP college for degree and PG courses (A), MVP campus, Visakhapatnam.
3. & 4. student, Department of Microbiology, GVP
college for degree and PG courses (A) MVP campus, Visakhapatnam
ABSTRACT
Indian Fragrant rose - Rosa
Indica is very popular species and is a symbol of beauty and divinity that
possesses astringent, sedative, anti-inflammatory, and antidepressant
properties. Its blooms are collected commercially for rose oil, which is used
in perfumery, and for its exquisite scent.
In this study rose flowers were
carefully collected and air dried to form a fine powder under controlled
temperatures. The sample was subjected to Soxhlet extraction using 150ml of
methanol as solvent and qualitative phytochemical analysis was done which
showed positive results for carbohydrates, coumarins, flavonoids, steroids,
tannins, and terpenoids.
Another affinity-based technique
called thin layer chromatography was performed which showed positive result for
the presence of flavonoids, terpenoids, steroids and coumarins when observed
under ultraviolet light with an Rf value of 0.865, 0.560, 0.447 and 0.373
respectively.
The crude extract showed
increasing anti-oxidant activity with increasing concentration. It was observed
that sample possesses total antioxidant capacity equivalent to 45.38mg/g
ascorbic acid at higher concentration(100µg/ml). The anti-oxidant activity of
Sample (rose flower extract) was observed to increase with increase in the
concentration of sample, with highest activity shown at 500mg/ml, 86.2%.
The MTT assay results suggest
that the given test sample showed cytotoxic as well as anti-cancer in nature on
human breast cancer cells with the IC50 value of 63.5µg/ml.
Keywords: Anti-inflammatory, anti-depressant, Thin layer
Chromatography etc.
Phytochemical screening of Calycopteris
floribunda leaf extracts
Archana Kandala1,
Divya Vani Koraganji2 , Prameela Kandra2*
1Department
of Biotechnology, GITAM School of Science, GITAM Deemed to be University,
Visakhapatnam-530045, archana9.kandala@gmail.com,
2*
Department of Biotechnology, GITAM School of Technology, GITAM Deemed to be
University, Visakhapatnam - 530045, Andhra Pradesh, India. pkandra@gitam.edu,
ABSTRACT
Medicinal plants have been used
for centuries together across the world for their therapeutic properties for
overall wellbeing and treating specific ailments. On the other hand, despite
the latest advancements in medicinal chemistry, Cancer treatment is still
unresolved. Medicinal Plants are now a ray of hope for the adjunctive cancer
therapies due to their inhibitory effect on growth in Cancer cells. The
bioactive compounds present in these plants might potentially inhibit the
growth in cancerous cells and induce apoptosis. Calycopteris floribunda,
a perennial herb found in the moist deciduous forests of India, is renowned in
folk and Ayurvedic medicine. This study focuses on the phytochemical activity
of bioactive compounds extracted from the leaves of C. floribunda. Leaf
extracts were obtained using Hexane as a solvent through solvent extraction,
resulting in pure extracts after 21 cycles. These extracts were then evaluated
for their phytochemical activity.
*Corresponding author
Dr.
K. PRAMEELA, M. Sc., Ph.D
Associate
Professor
Department
of Biotechnology
GITAM
School of Technology, GITAM Deemed to be University
Visakhapatnam
– 530 045
Andhra
Pradesh, India
E-mail:
pkandra@gitam.edu
Tel:
+91-9440311012, +91-9492466554.
ISOLATION, IDENTIFICATION AND
MOLECULAR CHARACTERIZATION OF SPOILED POTATO
Namrata Panda1*,
Prerna Nishad2*, Dr.Jogeswar Gadi3,
Dr. P. Rosina George4
1 Student of 3rd Bsc (BBC), St. Joseph's College
for women
2 Student of 3rd Bsc (BBC), St. Joseph's College
for women
3
CEO & Director of SMDRC LAB
4
Assistant Professor, Department of Zoology, St. Joseph's college for women
ABSTRACT
The study is aimed to isolate
bacteria present in spoiled potatoes and its molecular characterization is
conducted. Samples (visibly spoiled potatoes) were collected from local nearby
markets and subjected to microbial isolation using standard culture techniques.
Multiple bacterial colonies were obtained and cultured. Morphological,
Biochemical tests and molecular analysis were conducted to identify the
isolates. Morphological characterization involved gram staining and biochemical
tests included antibiotic sensitivity assay. For Molecular characterization
universal bacterial primer that is 16s rRNA primer (Forward
-5’AGAGTTTGTCHYGGYTYAG 3’ and Reverse - 5’ ACGGCTACCTTGTTTACGACT 3’) gene
sequencing was employed. DNA was extracted from bacterial culture, and the 16s
rRNA gene was amplified using polymerase chain reaction (PCR).The amplified
products were sequenced and compared with known sequence in Database using
BLAST Tool to identify the bacterial isolate. The Acinetobacter strain was
found along with other bacterial species in our samples. This was found to be
gram -ve strain. This is further confirmed by gram staining after sequencing.
The Acinetobacter strain was found to be resistant to the antibiotics we used
(ampicillin, streptomycin, tetracycline & kanamycin).This highlights the
microbial diversity in spoiled potatoes and provides insights into potential
spoilage mechanisms. Understanding these bacteria can inform better storage and
preservation as well as safety control strategies to minimize potato spoilage
and economic losses.
Keywords: spoiled potato, microbial
isolation, bacterial culture, gram staining, PCR, antibiotic sensitivity, BLAST
tool, spoilage mechanisms.
* Author for Correspondence-
Miss Namrata Panda
& Miss Prerna Nishad
Student of 3rd BBC
Contact Number-
Mail id- namratapanda1718@gmail.com
ExtractionandCharacterizationofSilverNanoParticlesSynthesizedUsing
Plant Extract of Kedrostis foeditissima (jacq). Lin
Dr.J.Nirmala1*and
Dr.R.Pandian2
1DepartmentofPlantBiologyandPlantBiotechnology,
Presidency College, (Autonomous) Chennai, India
2UniversityofMadras,CSIRCLRI
Department of Bio technology, Tamilnadu, India
*Corresponding author
ABSTRACT
Nanotechnology is emerging as a rapidly growing
field with is applicationin science and technology for the purpose of
manufacturing new materials at the nanoscale level. The recent development and
implementation of new technologies have led to new era, the nanoparticle of bio
molecules in plants can acts as capping and reducingagents and they have
investigated in order to find an eco-friendly techniques for production of well
characterized .the present investigation was carried out to green synthesis of
Agno3 nano particle s by using the medicinal plant of Kedrostisfeotidissima.
They weresynthesized by mixing aqueous extracts and 1mM of agno3,
the formation of nanopaticles was monitored by visualizing color changes and it
was confirmed by UV-vis spectrophotometer, FTIR, XRD, SEM the result of various
techniques confirmed the presence Agno3 nanoparticls.
Keywords K.foeditissima,UV,FTIR,
XRD, EDAX, SEM
ISOLATION, IDENTIFICATION AND MOLECULAR
CHARACTERIZATION OF BACTERIA FROM SEA WATER
Sarah1*,
Dr. P. SARADA2
1.Student of 3rd
B.Sc (BBC), St. Joseph’s College for Women (A)
2.Head of Dept. of
chemistry, St. Joseph’s College for Women (A), Visakhapatnam
ABSTRACT
The study is aimed to isolate bacteria present in
sea water and its molecular characterization is conducted. Sea water
sample was collected from sea shore and subjected to microbial isolation using
standard culture techniques. Multiple bacterial colonies were obtained
and cultured. Morphological, Biochemical tests and molecular analysis were
conducted to identify the isolates. Morphological characterization involved gram
staining and biochemical tests included antibiotic sensitivity assay
for Molecular characterization. universal bacterial primer that is
16s rRNA primer (Forward -5’AGAGTTTGTCHYGGYTYAG 3’ and Reverse – 5’
ACGGCTACCTTGTTTACGACT 3’) gene sequencing was employed. DNA was extracted from
bacterial culture, and the 16s rRNA gene was amplified using polymerase
chain reaction (PCR).The amplified products were sequenced and compared
with known sequence in Database using BLAST Tool to identify the
bacterial isolate. The Enterobacter cloacae strain and Vibrio
alginolyticus strain was found along with other bacterial species in our
sample. These were found to be gram -ve strain. This is further
confirmed by gram staining after sequencing. Antibiotic sensitivity
assay test was performed. Vibrio alginolyticus bacterial species are
resistant to ampicillin , kanamycin, streptomycin and tetracycline where as Enterobacter
Cloacae species are susceptible to kanamycin, streptomycin and
tetracycline. Usually the two bacterial species identified as Enterobacter
cloacae and Vibrio alginolyticus are pathogenic to human health . The
bacterial population increases in Sea due to contamination and discharging of
wastes directly into the water bodies . It is Advisable to not to discharge the
wastes directly into the water bodies so as to decrease the Contamination level
in the sea . It is concluded that the bacterial strains identified will be
Helpful to humans in biodegradation.
Keywords:
sea water, microbial isolation, bacterial colonies , bacterial culture,
molecular analysis , gram staining , molecular characterization, PCR,
antibiotic sensitivity, BLAST tool, contamination, bacterial strains, gram -ve
bacteria, Enterobacter cloacae, Vibrio alginolyticus.
*Author
for Correspondence-
Miss Sarah
Student of 3rd BBC
Contact Number-
Mail ID:
sarah2703004@gmail.com
Toxicity Evaluation, Behavioral and Haematological
Studies of Azaxistrobin on Ctenopharyngodon idella (A Freshwater Grass Carp
fish)
Anapana gopal1,
Venkata rathnamma V2, DSS Ganesh3,
Nagaraju surarapu4
1,3,4 – Department of Zoology, Maharajah’s College
(Autonomous), Vizianagaram.
2 – Professor, Department of Zoology & Aquaculture, Acharya Nagarjuna
University, Guntur.
ABSTRACT
In this study, the acute
toxicity of Azoxystrobin, a fungicide, was assessed in Grass Carp
(Ctenopharyngodon idella) over 24, 48, 72, and 96-hour intervals at
concentrations ranging from 11 mg/l to 17 mg/l. Behavioral and hematological
responses were evaluated to gauge the physiological impacts of Azoxystrobin
exposure. Behavioral changes such as increased respiration rate and altered
swimming patterns were observed, along with morphological indicators like
enhanced mucous secretion. The toxicity of Azoxystrobin was found to be both
time- and dose-dependent, with significant mortality and hematological
alterations noted at higher concentrations. These findings underscore the
potential risks Azoxystrobin poses to freshwater ecosystems, highlighting the
need for further research to understand its environmental impacts and
regulatory implications. Limitations included the study's confinement to
laboratory settings and specific endpoints, cautioning against direct
extrapolation to natural environments or long-term exposures. This research
advances knowledge of Azoxystrobin's effects on freshwater fish and underscores
its role as a bioindicator in environmental monitoring studies.
Key words: Azoxystrobin, toxicity, freshwater fish,
Ctenopharyngodon idella, behavioral changes, hematological studies.
Corresponding author: Anapana Gopal.
Corresponding authors mail I’d: gopalzoology@gmail.com
A STUDY ON THE IMPACT OF
BACTERIAL DISEASES AND MANAGEMENT PRACTICES IN PENAEUS MONODON AT CHINTAPALLI REGION, VIZIANAGARAM DISTRICT,
ANDHRA PRADESH, INDIA
Kum. K.Radha1,Sri.
S. Nagaraju2 , Sri. D.Satya Siva Ganesh3 ,Sri.
Anapana Gopal 4
1 Assistant Professor in
Zoology , Maharajah’s College (Autonomous), Vizianagaram
2 Assistant Professor in
Zoology , Maharajah’s College (Autonomous), Vizianagaram
3 Assistant
Professor in Zoology , Maharajah’s College (Autonomous),
Vizianagaram
4 Maharajah’s
College (Autonomous), Vizianagaram
Abstract
Andhra Pradesh stands top in the
aquaculture production in India and shrimp farming is one of the major sources
of income. Now-a-days shrimp culture is facing many problems among them disease
mitigation became major issue for the shrimp farmers. A study was done to
evaluate the diseases affecting Penaeus monodon
farming in a coastal region of Vizianagaram district of Andhra Pradesh, i.e., Chintapalli Coastal region.Mostle the diseases that are responsible for huge
losses in Penaeus monodon culture is
found to be White Spot Syndrome Virus (WSSV), White Faecal Syndrome (WFS),
Black Gill Disease (BGD), Loose Shell Syndrome (LSS), Running Mortality
Syndrome (RMS), and Enterocytozoon Hepatopenaei (EHP) of various coastal regions of Andhra
Pradesh.In this,Chintapalli Coastal region in Vizianagaram district of the Andhra Pradesh was
selected for the identification prevailing diseases,causative agents, Dissolved
Oxygen(D.O) problems and implementation of biosecurity measures . It is
observed that, more disease related problems observed during the summer crop in
this area.Therefore it is suggested that by practicing better management
practices (BMP) by necessary biosecurity measures to prevent these diseases.
Keywords:Andhra Pradesh,BMP practices,diseases,Penaeus monodon
Mail Id:radhakodithala49@gmail.com
A Salt-tolerant Bacillus
species, Promising Rhizobacteria to Mitigate Salinity Stress in Rice and
Black gram plants
Bharati Mollety1,
1
Assistant Professor & HOD, Dept of Biotechnology(UG), Dr Lankapalli
Bullayya College,Visakhapatnam, INDIA
ABSTRACT
Bacillus species have show
strong persistence to almost all abiotic stresses because of their superior
metabolic/genomic background and capacity for spore formation. Thus, The
endophytic rhizobacteria in association with plants involve in
improving plant's tolerance and enhancing the fertility of soil. This work aimed to assess the diversity of
cultivable salt-tolerant Bacillus species in pneumatophores
from mangroves Avicennia alba, Exochoria agalocha and Acanthus
ilicifolius(.L). halophytic roots from Suaeda nudiflora
and Suaeda monoica , Acanthus ilicheniformis, grown in and around CORINGA WILDLIFE
SANCTUARY, ANDHRA PRADESH, INDIA. Based on morphological and Biochemical tests
twenty -seven bacillus strains were isolated and performed plant growth
promoting traits like Temperature tolerance, Salinity Tolerance, Plant
growth Promoting hormone IAA synthesis, Siderophore synthesis, Phosphate
solubilisation, Amylase, Protease & Carboxylase production, Chitinase
production, And the most potent salt-tolerant Bacillus strains
was identified on the basis of molecular analysis of 16s r-RNA sequencing. And,
conducted a
pot experiment to evaluate its potential as a substitute to lessen the
detrimental effects of saline soils on black gram and rice plants.
Corresponding
Author: Email id: molletybharati@gmail.com
Studies on production of pharmaceutically important
secondary metabolites using hairy root cultures of Indian sarasaparilla Hemidesmus
indicus (L) R.Br.
R.Chrisolite. Ch., Dr. P.
Subhashini Devi
Biochemistry, Andhra University,
Visakhapatnam
ABSTRACT
Hemidesmus indicus is common Indian medicinal plant widely used in
Ayurvedic, unani, homeopathic medicines. From ancient times Hemidesmus
indicus is used in folk medicines to cure diseases. In traditional Indian
system of medicine it is widely used as blood purifier, diuretic,
anti-rheumatic and anti-diarrheal agent and also possess anti-viper venom
activity. It is also known to possess activity against skin diseases, asthma,
bronchitis, epileptic fits in children and 'tridosha' diseases of the blood
leukarea kapha and vata. It is also used as flavouring agent for the
preparation of soft drinks and bakery products and as perfumery in cosmetic
industry. It contains various phytochemical constituents belonging to
the category glycosides, flavonoids, tannins, saponins, sterols and volatile
oils. The multiple uses of this plant species has led to the indiscriminate
collection from its known habitats and consequent scarcity in the supply of raw
materials for the traditional herbal drug industry. The scarcity of the
genuine raw material in nature has forced the drug makers to use other species
roots. As it is a deep rooted plant harvesting of the roots from the field with
sparse distribution of the plant is labour intensive and uneconomic. Since the
plant is rich source of various secondary metabolites and scarcity of the
supply of raw materials. It deserves research endeavour for establishing tissue
culture protocol towards their conservation and also production of secondary
metabolites using hairy root cultures through gene transfer techniques.
Keywords:
Hemidesmus indicus, Nodal explants, In vitro regeneration,
secondary metabolites, Agrobacterum rhizogens, Gene transformation,
Hairy roots, rol primers, HPLC, purification, In vitro cytotoxicity.
Fungal elicitors Alternaria sesami enhanced
biosynthesis of antioxidant compounds in callus cultures of Sesamum indicum
L
Dr.M.Padma Sundari
Assistant Professor
(Botany)St.Joseph’s College for Women(A), VSKP
ABSTRACT
Sesamum indium L., belonging to the Pedaliaceae family is an
important oil seed crop of the world. Phytochemical investigation of Sesami
has revealed the presence of biologically active compounds namely lignans
glucoside . It is known that several lignin compounds and phenolic compounds
have potent antioxidant properties (Osawa & Naimiki, 1981; Osawa, 1985). It
is considered that these compounds play an important role in preventing
oxidative damage in Sesami seeds. Elicitation is the induction of
secondary metabolites production by either biotic or abiotic treatments. The
use of pathogenic fungal preparations as elicitors has become one of the most
important and successful strategy to improve secondary metabolites production
in plants cell culture. The objective of this research was to develop
phytochemical production from Sesamum indicum L from callus
culture after exposure to biological elicitors (Alternaria sesami and Cercospora
sesami) for eventual medical usage, to analyze these potential medicinal
metabolites.The methods used include plant tissue culture and biochemical
analysis. First, the callus cultures were developed from different
explants (hypocotyls and coteleydons). After the callus culture was developed,
it was treated with different concentration of biotic mycelial extracts and
their effects on callus growth and phenolic production were assessed. To
identify and quantify the phenolic compounds in the callus, the total phenolics
were extracted and assayed by Folin-Ciocalteau method and the radical
scavenging behaviour was assayed by DPPH (diphenyl-1-picrylhydrazyl) system.
In Alternaria sesami
treated cotyledonary callus, the total phenolic content increased in the first
two weeks for all four concentrations but decreased in the third week and
increased slightly in the fourth week except for 1.0 % treated callus.
Hypocotyl callus of
Alternaria sesami treatments showed variation in total phenolic
production with Alternaria treated extracts, the total phenolic content
increased up to the first two weeks and decreased in the third and fourth
week.When compared to the controls, sesamin production was enhanced to 1-3
folds in all treatment except in 0.5 % concentration of cotyledonary callus
where in the third week the sesamin production was similar to the controls.
Thus, elicitors treated callus response increased phenolic compounds to that of
the control. The 2,2-diphenyl-picryhydrazyl ( DPPH) activity is a proper
indicator for investigating the free radical scavenging activities of phenolic
compounds when Sesamum indicum L. hypocotyl and cotyledon
callus were cultured with 0.5 % - 2.0 % concentration of mycelial extracts of
both fungi. With Alternaria
mycelial extract, maximum activity was observed at 0.5 % in the first week of
treatment (30.43 µg/ml) and from the second week onwards, the free radical
scavenging activity decreased in succeeding weeks in the hypocotyl callus.
Key Words: Sesamum indicum L.,Elicitor ,Callus
culture, Antioxidants.
MAIL ID: mail:mpadmas13@gmail.com
First occurrence of larval Eustrongylides
(Nematoda: Dioctophymidae) in freshwater fish Channa punctatus in
Visakhapatnam, A.P India.
Dr. P. Rosina George
Assistant Professor in Zoology,
St. Joseph’s College for Women (A), Visakhapatnam, India
9948822398
ABSTRACT
Nematodes from the genus Eustrongylides
infect freshwater habitats' resident fish species and fish-eating birds.
The intake of raw or undercooked fish exposes a person to nematodes from the
genus Eustrongylides, which are potentially harmful to humans. Twenty-five specimens of Channa punctatus
were caught from different fish markets from Visakhapatnam for parasitological
examination (2009). The presence of three different Eustrongylides sp
larva in the intestine was revealed in five fish. This finding represents the
first determination of the larvae in the Channa punctatus in
Visakhapatnam. The prevalence of the parasite was 20%.
Keywords:
Eustrongylides; Nematodes; Channa punctatus; Visakhapatnam
Effective treatments for breaking dormancy in mung
bean ( Vigna radiata) seeds
1.
Hanumanthu Thanuja, BSc Agriculture and Rural development
St
Joseph college for women.(A).
2. Landa
Urmila, Assistant professor, Department of Seed science and technology
Mail
id: urmila.landa31@ gmail.com, St Joseph college for women (A).
ABSTRACT
Seed dormancy is a condition in which seed is
unable to germinate even under ideal conditions. The causes of dormancy include
hard seed coat, under developed embryo, lack of supply of enzymes, chemical
inhibitors. Some of the effective treatments we conducted on mung bean
variety WGG-42 in laboratory. An experiment was conducted in a
completely randomized design with four replications. Green gram seeds are
treated with Gibberellic acid 3,hot water treatment, prechilling
treatment, and non treated seeds. Green gram seeds are soaked in
GA3 of 100 ppm for 8 hours ,pre chilling treatment with 7° c for 5
days,hot water treatment seeds are soaked in 80°c for 5minutes. Seed
germination and growth parameters were recorded The highest germination
percentage 95% , root length (10.05cm ), shoot length (17.05cm)
was observed in GA3 of 100 ppm soaked seeds for 8 hrs followed by pre
chilling treatment 7° c for 5 days .where as the lowest found in
non treated seeds.
Key
words: Dormancy , Gibberellic acid,
Pre- chilling, Scarification, Stratification
Author
for correspondence:
Miss Hanumanthu Thanuja
Student of 3rdAGRD
Contact no: 9959422119
Mail
id: hanumanthuthanuja@gmail.com
Bioinformatics,
Environmental Sciences and Nano Sciences
|
S.No |
Name of the Participant |
Designation |
Name of the Institution |
Place of the Institute |
|
1 |
K. Nischala Deepthi |
Research Scholar |
GITAM University |
Rushikonda |
|
2 |
Abhishek Kumar Verma |
Research Scholar |
Manipal University Jaipur |
Jaipur, Rajasthan |
|
3 |
Dr. P.K.PRAVEEN KUMAR |
Professor |
Sri Venkateswara College of Engineering |
Sriperumbudur, Tamilnadu |
|
4 |
Rahul Karra |
Research Scholar |
GITAM University |
VIZAG |
|
5 |
Dr.P.Padmavathi |
Associate Professor |
Sri Padmavathi Women's Degee and PG College,Tirupathi |
Tirupati |
|
6 |
HARIKA Allamsetty |
Research Scholar |
SDMSMK, Vijayawada |
Vijayawada |
|
7 |
Dr.Pallavi Atmuri |
Assistant Professor |
SDMSMK |
Vijayawada |
|
8 |
Anshika Upadhyay |
UG Student |
st joseph's college
for women |
Visakhapatnam |
|
9 |
Dr L MAHMMAD BHAKSHU |
Assistant Professor |
Dr YSR Government
Degree College |
Vedurukuppam,
Chittoor (Dt) A.P. 517569 |
|
10 |
|
|
|
|
Exploring Plant Compounds (Centella
asitica) Interactions with Streptococcus mutans Drug Targets
K. Nischala Deepthi1
and Dr. A. Krishna Chaitanya2
1Department of Biochemistry, TSR & TBK College,
Visakhapatnam.
2Department of Life Sciences, School of Science,
GITAM Deemed to be University, Visakhapatnam-530045, Andhra Pradesh, India.
ABSTARCT
Dental caries is said to be a
common chronic disorder distributed worldwide. It is estimated that globally, 2
billion people suffer from caries. It is defined as a bacterial disease of
calcified tissues of teeth, which is characterized by demineralization.
Demineralization is caused by several pathogenic microorganisms in which Streptococcus
mutans play a vital role as it promotes biofilm formation, acid tolerance,
and carbohydrate metabolism. The current study aims to evaluate interactions
between the 13 plant compounds of Centella asitica targeting the
proteins of S. mutans. Centella asitica has been proven to possess potential phytochemicals
and it has been utilized as a medicinal drug in treating several diseases. The methodology includes identifying plant
compounds and drug targets of S. mutans from the literature. The 13
compound details were obtained using PubChem and subjected to Lipinski rule for
drug-likeness and ADMET properties prediction using Swiss ADME. Based on the
best properties, 6 compounds were selected for further docking studies. Uniprot
and PDB were used to obtain the molecular function and 3D structures of the 14
target proteins of S. mutans, out of which two were identified as
potential targets. Ligand-receptor docking was done using the Swiss-Dock tool.
The docking studies revealed that the dodecanoic acid out of 6 selected
compounds showed good binding; hence, it could act as a potential ligand on
which further studies needed to be carried out.
Keywords:
Dental caries, Demineralization,
S. mutans, ADMET properties, Docking
“Unveiling Promising
Antituburcular Candidates: A Multi-Database Exploration through Integrated
Structure and Ligand based Pharmacophore-Based Screening and Molecular Dynamics
Simulation of NadD Inhibitors”
Abhishek Kumar Verma1
and Sandeep Kumar Srivastava1*
1Structural
Biology & Bioinformatics Laboratory, Department of Biosciences, Manipal
University Jaipur, Jaipur, Rajasthan 303007, India
ABSTRACT
The tuberculosis (TB) epidemic continues despite
concerted efforts, which means new treatment approaches must be investigated. MtbNadD
has emerged as a potential target for latent and active tuberculosis, according
to recent studies. We describe a pharmacophore-based virtual screening
methodology in this work to find putative MtbNadD inhibitors. Molecular
docking, which focuses on the NADP binding pocket of NadD, identified a number
of compounds with robust and significant binding affinities. These highly rated
inhibitors show potential for additional research and development as
antituburcular drugs, which could provide a fresh approach to treating
tuberculosis. Strong binding and interactions were seen between Pharm20, which
came from structure-based pharmacophore modeling, and Pharm25, Pharm34,
Pharm35, Pharm46, and Pharm52, which came from ligand-based pharmacophore
modeling, with important active amino acids in the MtbNadD structure.
Their effectiveness was also confirmed by evaluation utilizing 200 ns MD
simulations, with particular attention on the final 25 ns trajectory for MMPBSA
estimates. MD simulations confirmed that the inhibitors were able to adjust and
form stable complexes within of NadD's binding pocket. Additionally, the
significantly low binding energies from MMPBSA analyses highlighted the
important interactions with the active amino acids of NadD. As a result,
Pharm20, Pharm25, Pharm34, Pharm35, Pharm46, and Pharm52—the compounds that
were found—have a great deal of potential to develop a new class of
antimicrobial inhibitors that are especially designed to fight tuberculosis,
which might completely alter how the disease is treated.
Keywords: Mycobacterium
tuberculosis; NAD Biogenesis; NadD;
Structure-based pharmacophore modeling; Ligand-based pharmacophore modeling;
Virtual screening; Drug discovery
Email: sandeepkumar.srivastava@jaipur.manipal.edu
HSP90 isoforms – important
targets for Liver Fibrosis
Dr. P.K.Praveen Kumar*
*Professor, Department of
Biotechnology, Sri Venkateswara College of Engineering, Pennalur, Sriperumbudur
Tk – 602117, TN, India
ABSTRACT
Liver fibrosis is a condition
where there is excessive accumulation of scar tissue (fibrous tissue) in the liver
and it is the intermediate stage of Hepatocellular carcinoma, a primary liver
cancer. This fibrous tissue replaces normal liver tissue and disrupts the
structure and function of the liver. It is typically a response to chronic
liver injury from various causes, such as: Alcohol abuse, Non-alcoholic Fatty
Liver Disease (NAFLD), Non-alcoholic Steatohepatitis (NASH), Chronic viral
hepatitis, biliary tract disorders and Autoimmune hepatitis. Heat Shock Protein
90 (HSP90) and mitochondrial HSP90, also referred to as TRAP1 are important
critical chaperone target receptors for early diagnosis and targeting Liver
Fibrosis. Both HSP90 and TRAP1 expression was found to be higher in liver
fibrosis patients. Hence, the importance of HSP90 and TRAP1 inhibitors mechanism
and mitochondrial targeted delivery of those inhibitors function are widely
studied. This review also focuses on importance of protein–protein interactions
of HSP90 and TRAP1 targets and association of its interacting proteins in
various pathways of HCC. To further elucidate the mechanism, systems biology
approaches and computational biology approach studies are well explored in the
association of inhibition of herbal plant molecules with HSP90 and its
mitochondrial type in Fibrosis.
Keywords: Fibrosis,
HSP90, TRAP1, Non-alcoholic Fatty Liver Disease (NAFLD), Non-alcoholic
Steatohepatitis (NASH).
WATER USE EFFICIENCY STUDIES ON
KALESHWARAM LIFT IRRIGATION PROJECT
Rahul Karra 1,
M. Kiranmai Reddy2
1Research Scholar, Department of Environmental
Sciences, School of Science, Gandhi Institute of Technology and Management
(GITAM – Deemed to be University)
2Associate Professor, Department of Environmental
Sciences, School of Science, Gandhi Institute of Technology and Management
(GITAM – Deemed to be University).
Abstract
The Kaleshwaram Lift Irrigation
Project (KLIP) is a massive undertaking in Telangana, India, aiming to provide
water security to millions. However, water use efficiency (WUE) is crucial for
the project's long-term sustainability. This paper examines existing studies on
WUE in the context of KLIP. It analyzes factors impacting WUE, including canal
seepage losses, on-farm practices, and crop selection. The paper further
explores potential strategies to enhance WUE, such as canal lining, precision
irrigation techniques, and promoting water-efficient crops. Finally, it
identifies areas for further research to optimize water use within KLIP. The
Kaleshwaram Lift Irrigation Project (KLIP) in Telangana, India, stands as a
monumental undertaking aiming to revolutionize agriculture across 14 districts.
With ambitions to irrigate over 18.5 lakh hectares of land by diverting water
from the Godavari River, KLIP represents a significant leap towards achieving
water security for millions. However, amidst the promise lies a crucial
challenge: ensuring optimal water use efficiency (WUE) for the project's
long-term sustainability. India faces a burgeoning water crisis. The World
Resources Institute classifies India as "high-risk" in terms of water
stress, with per capita water availability falling drastically from 1,545 cubic
meters in 2000 to a mere 1,173 cubic meters in 2017 . In this context,
KLIP's success hinges on its ability to deliver irrigation water without
exacerbating existing water scarcity concerns. This paper delves into the
critical issue of WUE in the context of KLIP.
Keywords– Kaleshwaram Lift Irrigation Project (KLIP), Water
Use Efficiency, Irrigation Management, Canal Seepage, On-farm Practices,
Precision Irrigation
Understanding Interactions and
Promoting Sustainable Environment.
Dr P Padmavathi
Department of chemistry , SPW
Degree and PG College, Tirupati.
Abstract
Environmental science integrates various
disciplines to study the relation between human beings and their surroundings,
includes eco system, pollution control, resource management, and
sustainability. This abstract explores all the areas concerned with chemical
and biological surroundings in which the organisms live. The prominent global
problems such as climatic changes, biodiversity loss, and pollution are
discussed, reinforcing the necessity for ingenious answers and universal
cooperation. Environmentalists use scientific principles to inform policies and
practices that increase environmental health and tenacity for forth coming
generations. This interdisciplinary approach is essential for solving hazardous
environmental issues and achieving sustainable development goals.
Email: padmavathipettela967@gmail.com
Preliminary Phytochemical and Pharmacological
Investigations of
Ipomoea obscura
Dr. Pallavi. A, Harika .A,
Department of Biochemistry,
Sri Durga Malleswara Siddhartha
Mahila Kalasala, Vijayawada-520010.
ABSTRACT
Ipomoea obscura,
also known as morning glory or Vachagandha, is a creeping vine belonging
to the family Convolvulaceae, widely distributed in various parts of the world.
Screening of phytochemicals is a preliminary step in the detection of bioactive
compounds present in particular medicinal plant and leads to novel drug
discovery .In the present study Ipomoea obscura plant was
identified in order to perform the phytochemical analysis by various standard
methods and reported the presence of tannins, flavonoids, phenolics, saponins,
steroids, cardiac glycosides and alkaloids and quantitative
analysis of tannins, saponins and flavonoids were investigated
. The presence of these phytochemicals can be correlated with medicinal
potential of the plant. Further pharmacological studies are carried out which
are responsible for their activities and other medicinal values. The aim of the
study deals with the phytochemical screening and pharmacological aspects of Ipomoea
obscura, which includes phytochemical screening for different potent
chemicals, antibacterial activity against human pathogenic strains [Salmonella
sp. (MTCC); Staphylococcus aureus, Bacillus subtillis. Escherichia coli,
Pseudomonas sp. etc]. The results provide justification for the use of the
plant as a source of innovative plant based medicines to treat various
infectious diseases.
Keywords:
Phytochemical screening, antibacterial activity, Ipomoea obscura.
PLANT INSPIRED NANOSENSING
TECHNOLOGY: A CUTTING EDGE ADVANCEMENT IN BIOMIMETICS
Anshika Upadhyay1,
S.L Keerthana2, Dr M.Padma Sundari3
1year Student ,Department of
botany,St Joseph’s College for Women(A),VSKP
2 year Student ,Department of
botany,St Joseph’s College for Women(A),VSKP
3 Assistant Professor,
Department of botany,St Joseph’s College for Women(A),VSKP
ABSTARCT
Biomimicking has inspired
several designers, architects and engineers. Mimicking nature’s elegant
designs, produced after a thorough and elaborate process of natural selection
is a familiar concept to human civilization. Plants dominate the earth and all
of the biodiversity depends on them.
Humans are no exception to it as
we depend heavily on plants for our livelihood, food, industries and
innovations. Nanotechnology, an emerging field of the 21st century, also draws
inspiration from plants to develop new age nanosensors. Advanced research in
nanosensing technology has a promising future in the fields of medicine,
agriculture, Ecology , environmental science,robotics,photonics etc. This
article addresses the cutting edge nano-sensing technology inspired by plants.
It also has the potential to lead us to a sustainable future. Through
this paper, the following areas will be explored. (1) Key concepts of
bioinspired nanosensing technology (2) Emerging plant-inspired nanosensing
technologies in various fields (3) Concerns and ethical issues.
Keywords
Biomimetics, Nanosensing, Engineering, Phyto
Mimetics
Evaluation
of essential oil of Bursera penicillata for Chemical composition and in
vitro antimicrobial or antioxidant activities
L. Prasanna Anjaneya Reddy1,
L. Md. Bhakshu2, L. Veeranjaneya Reddy3,
B.N. Reddy1 and K. Venkata Ratnam4*
1Osmania University College for Women, Department of
Botany, Osmania University, Hyderabad, Telangana, 500 001.
2Dr. YSR Government Degree College, Vedurukuppam,
517569; Chittoor District, A.P.
3Deparment of Microbiology, Yogi Vemana University,
Kadapa, Andhra Pradesh 516 003,
4Department of Botany, Rayalaseema University,
Kurnool, Andhra Pradesh – 518 007
*Corresponding author: drvenkatapkd@gmail.com
Abstract
Bursera penicillata (Sesse & Moc. ex DC.) Engl. (syn. B.
delpechiana Poss. ex Engl.) oil is extensively used as a fixative for
high-grade perfumes, cosmetic products and in the manufacture of transparent
soaps, is present in all parts of the plant, the highest yield can be obtained
from husk of the berries. The present investigation was emphasized on chemical
characterization and the antimicrobial or antioxidant activities of the
essential oil of B. penicillata leaves and stem bark were not
yet.
The volatile oil was obtained
from leaves or stem bark through steam distillation were yielded, 0.6% or 0.3%
(v/w) respectively. The essential oil was characterized by gas chromatography
coupled with flame ionization detector (GC-FID) and GC-MS attached with
NIST-Mass 2006 data base. The retention indices were calculated by application
of a modified Kovat’s procedure. The antioxidant activity was tested ammonium
molybdate and DPPH reducing assay. The important components of the leaf oil
were, terpenolene (34.1%), pinacrveol (16.84%), t-terpenene (9.97%)and
citronellyl acetate (8.4%) and a-longipinene (5%) where the stem bark yielded
cadiene (26.5%), b-phyllendrene (25.2%), carvone (15.8%),
methylallyltrisulphide (6.6%), caryophellene (6.2%) and methylallyl sulphide
(5.1%) as the major chemical components.
The oils were exhibited a
significant antimicrobial activity on the human pathogenic microorganisms such
as, bacterial (Bacillus cereus, Staphylococcus aureus, Streptococcus
feacalis, Escherichia coli, Proteus vulgaris, Pseudomonas aeruginosa) and
fungal pathogens (Candida albicans and C. tropicalis) which
effected at significantly lower concentrations. The oils were exhibited a good
antioxidant activity is also point of discussion. The oils find applications in
the medicine or development of cosmetics from the oil.
KEY WORDS: Bursera penicillata; essential oil
composition; antimicrobial activity, antioxidant activities.
AN
OVERVIEW ON THE MICROPLASTICS AND ITS EFFECTS ON THE
ENVIRONMENT AND HEALTH
L. Md. BHAKSHU1*, V. PRABHAKAR RAO2, P. VENKATESU3 AND
C. MEERA SAHEB4
1-3, Dr. YSR Government Degree College, Vedurukuppam, Chittoor
(Dt), 517569
4PVKN. Government College (A), Chittoor, 517002
*Corresponding
author: lmbakshu@gmail.com
ABSTRACT
Microplastics are small plastic particles in the environment whose size fall in the range five mm to one micrometer. Recently microplastics were found in the ice of arctic region which shows that they can reach any
corner of the world posing many dangers. Microplastics are becoming a potential risk
factor to all the living organisms and slowly it is deteriorating the health, living environment and biodiversity.
Microplastics contain a number of toxic chemicals which pose severe risks to
human health. The biggest health risk associated is with the chemical Bisphenol
A (BPA), which is used to harden plastics. BPA causes alterations in liver
functioning, insulin resistance, foetus development in pregnant women, the
reproductive system, and brain functioning. Microplastics are produced through
the fragmentation of larger plastic items like bottles, bags, and
packaging material. They are also produced from microbeads used in
personal care products like exfoliating scrubs, toothpaste, fibres released
during the washing of synthetic textiles, weathering and degradation of plastic
debris in the environment. Microplastics are secondary polluting agents
originated from the plastics and easily enter in to the ecosystems and inside
the bodies of living organisms causing a great menace to human kind. The
present review focusses on the structural, functional aspects in addition to
its ill effects. The possible solutions to guard from the microplastics are
also being discussed in detail. The scientists and environmentalists have been
focussing on the sustainable usage to avoid the microplastics and to make
eco-friendly substances.
Key Words: Microplastics, effects on environment and health,
sustainable materials
POSTER PRESENTAIONS
|
S.No |
Name of
the Participant |
Designation |
Stream
Selected for Presentation |
Name of
the Institution |
Place of
the Institute |
|
1 |
Bhavana |
UG
Student |
Applied
Sciences |
B.v.k
degree college |
Dwarka
nagar |
|
2 |
Swetha
Chinthala |
Research
Scholar |
NanoSciences |
GITAM
(Deemed to be) University |
Visakhapatnam |
|
3 |
Sayantan
Dalapati |
UG
Student |
Clinical
Sciences |
BVK
Degree College |
Dwarka
nagar |
|
4 |
Yeshwitha.K & Deepika S |
UG
Student |
Clinical
Sciences |
St.
Joseph's College for Women |
Visakhapatnam |
|
8 |
B. Sophia charlie, Kundana, Rishitha |
UG Student |
NanoSciences |
St. Joseph's College for Women |
Visakhapatnam |
|
10 |
Afreen sarveri |
UG Student |
rDNA Technology |
St. Joseph's College for Women |
Visakhapatnam |
|
11 |
BuddhaRaju bharathi veda samhita |
UG Student |
Nanosciences |
St. Joseph's College for Women |
Visakhapatnam |
|
12 |
Likhita konathala, Samhitha, Reshma |
UG Student |
NanoSciences |
St. Joseph's. College for women
(A) |
Visakhapatnam |
|
13 |
B. TANISHKA DEVI |
UG Student |
NanoSciences |
St. Joseph's. College for women (A) |
Visakhapatnam |
DNA polymorphisms and Disease
Identification
Sayantan1*,
Bhavna2, NSM Jyothi3
1*-Student of
BSc BTBCC, BVK Degree College, Visakhapatnam
2- Student of BSc CBZ, BVK
Degree College, Visakhapatnam
3- (M.Phil)
Abstract
Genetic differences among people within a community
are referred to as DNA polymorphism.SNPs, insertions, deletions, and repeats
are a few types.Procedure: Gathering samples, extracting DNA, amplifying it,
genotyping it, and analysing the results.PCR, bioinformatics, and
next-generation sequencing are important technologies.Applications include risk
assessment, personalised medication, early diagnosis, and the identification of
new diseases.Diseases that can be identified include Alzheimer's (APOE ε4), Type
2 Diabetes (TCF7L2), Breast Cancer (BRCA1/2), and Cystic Fibrosis
(CFTR).Benefits include early detection, better prognosis, lower expenses, and
precision treatment.Difficulties include high prices, complicated data, moral
dilemmas, and restricted accessibility.Future directions: advancements in gene
editing, increased genetic database size, and AI integration.Investments in
research, a strong data infrastructure, and educational initiatives are
necessary developments. Impact on healthcare: proactive health management and
individualised care.Economic potential: Opportunities for global leadership and
the biotech sector's growth.Protecting privacy and avoiding genetic prejudice
are ethical issues.International cooperation: pooling resources and knowledge to
tackle health issues.In conclusion, despite current obstacles, DNA polymorphism
analysis has enormous potential to transform healthcare.
Keywords
Variations in DNA,SNPS
Identification of Diseases,Sequencing of genes,Individual prescription
drugs,Cancer treatment
email id : dalapatisayantan169@gmail.com
Exploring the therapeutic potential of Andrographis
paniculata derived Silver Nanoparticles in Cancer.
Swetha Chinthala1,
Siri Chandana Gampa2, Sireesha V Garimella3.
Department of Life Sciences,
School of Sciences
GITAM (Deemed to be University),
Visakhapatnam.
Andhra Pradesh- 530045
Abstract:
Medicinal plants and pharmaceuticals made from
plants, have long been used to treat a wide range of illnesses. Approximately
80,000 plant species have been discovered and harnessed for their medicinal
properties across the globe. India has the most extensive, oldest, diverse, and
adaptable cultural legacy when it comes to the utilization of medicinal herbal
plants.
Andrographis paniculata, a widely recognized
medicinal plant, has garnered attention for its therapeutic properties. The
plant's flavor is entirely bitter, earning it the moniker "King of
Bitter" from its intense bitterness. This study investigates the synthesis
of silver nanoparticles (AgNPs) using Andrographis paniculata leaf extract and
evaluates their antimicrobial and cytotoxic activities. The synthesis of AgNPs
was confirmed by UV-Vis spectroscopy, revealing characteristic absorption peaks
indicative of nanoparticle formation. The antimicrobial efficacy of AgNPs was
assessed against a panel of pathogenic microorganisms, demonstrating
significant inhibition, particularly against Gram-positive bacteria.
Furthermore, cytotoxicity assays using mammalian cell lines indicated
dose-dependent toxicity of AgNPs, highlighting their potential biomedical
applications. This research underscores the dual functionality of Andrographis
paniculata-derived AgNPs as promising antimicrobial agents and cytotoxic agents
warranting further investigation for therapeutic development. Overall, this
study highlights the promising bioactive properties of AgNPs synthesized from
Andrographis paniculata, contributing to the growing body of research on
nanotechnology-based approaches to combat microbial infections and explore
cytotoxic effects in medical applications.
Email- swethachinthala21@gmail.com
Organ
Printing: A Revolutionary Approach to Tissue Engineering and
Regenerative Medicine
K. Yeshwitha 1*, S. Deepika2*, Dr.P.Mary anupama 3*
1,2,Students of 3rdBsc (BBC),
St. joseph’s college for women(A),
3. Head of the Dept. of Biochemistry, St. joseph’s
college for women (A), Vsp
ABSTRACT
Organ printing is a cutting-edge
biotechnology that enables the fabrication of functional three-dimensional (3D)
organs and tissues using living cells and biomaterials. This innovative
approach combines advances in stem cell biology, biomaterials science, and 3D
printing technology to create organs and tissues that can replace or repair
damaged ones. The organ printing process involves the selection and expansion
of relevant cell types, the design and fabrication of biomaterial scaffolds,
and the precise deposition of cells and biomaterials into a 3D structure using
a printing device. The resulting constructs are then matured and conditioned to
promote tissue formation and functionality. Organ printing has the potential to
address the shortage of organs available for transplantation, enable
personalized medicine, and revolutionize the field of tissue engineering and
regenerative medicine. With its ability to create complex tissue architectures
and functional organs, organ printing holds immense promise for transforming
the treatment of a wide range of diseases and injuries, and improving human
health outcomes.
Key words : Organ printing, Tissue engineering, Regenerative medicine,
3D printing, Biomaterials, Stem cell biology, Scaffold fabrication,
Personalized medicine.
Miss K. YESHWITHA
Miss S. DEPIKA
Students of 3rd
BSc BBC
Mail ID : kyeshwitha@gmail.com
: Deepikahhsingampalli@gmail.com
GREEN NANOTECHNOLOGY
Student of the St. Joseph’s College For
Women (A)
S. Kundana and B.
Sophia
ABSTRACT
Green
nanotechnology focuses on the development and application of nanomaterials with
an emphasis on environmental sustainability and reducing ecological impacts.
Key areas include eco-friendly nanomaterial synthesis, environmental
remediation, and energy efficiency. This approach integrates principles of
green chemistry and green engineering to create safer, renewable, and
recyclable materials. Applications range from improved water treatment and
pollution control to advanced energy storage solutions. Green nanotechnology
aims to balance technological advancement with environmental stewardship,
addressing global challenges like climate change and resource depletion while
promoting sustainable development.
Keywords:
Green
nanotechnology, sustainability, eco-friendly, nanomaterials, green chemistry,
environmental remediation, energy efficiency, renewable resources, pollution
control, sustainable development.
Author for correspondence
Name: S. Kundana and B. Sophia Affiliation:
2nd B Sc. Biotechnology
St. Joseph’s College For Women (A)
Visakhapatnam
Phone no: 6301162662 ; 93460 04061
Email id: kundanasanapathi@gmail.com
NANO
TOXICOLOGY
ABSTRACT
By
Students of St. Joseph’s college
for women
Nanotoxicology is an
emerging field that addresses the potential health and Environmental risks
associated with nanomaterials. nanotoxicology Investigates the bioaccumulation
and persistence of nanomaterials in the Environment, their potential to disrupt
ecological systems. By integrating toxicological assessments with nanomaterial
design and regulatory Frameworks, nanotoxicology strives to ensure the
safe and sustainable Development of
nanotechnology, minimizing risks while maximizing benefits To society.
B.B.V. Samhitha,
K.Likitha, A.Reshma
2nd
BSC BIOTECHNOLOGY
Visakhapatnam
9346706569
samhithabharathivedha@gmail.com
NANO BIOSENSORS
ABSTRACT
Student of St. Joseph college for
women
In recent years, there has been immense
advancement in the development of nanobiosensors as these are a fundamental
need of the hour that act as a potential candidate integrated with
point-of-care-testing for several applications, such as healthcare, the
environment, energy harvesting, electronics, and the food industry.
Nanomaterials have an important part in efficiently sensing bioreceptors such
as cells, enzymes, and antibodies to develop biosensors with high selectivity,
peculiarity, and sensibility. The combination of nanostructured materials and
biosensors is generally known as nanobiosensor technology. These miniaturized
nanobiosensors are revolutionizing the healthcare domain for sensing,
monitoring, and diagnosing pathogens, viruses, and bacteria.
Author
for correspondence
B.
TANISHKA DEVI
(6392690130)
V.
TEZASWWIEE
(9247966535)
P.
YERNI LAXMI BHAVANI
(9347106812)
2nd
YEAR Bsc BIOTECHNOLOGY
ST.JOSEPH
COLLEGE FOR WOMEN ,VISAKHAPATNAM
EMAIL
ID:
Clinical Sciences
|
S.No |
Name of the Participant |
Designation |
Name of the Institution |
Place of the Institute |
|
1 |
S.M.V Harsha Vardhan |
UG Student |
Srinivasarao College of Pharmacy |
Pm Palem Visakhapatnam |
|
2 |
N. Naga Varshitha |
UG Student |
Srinivasarao college of pharmacy |
PM. Palem, Vizag |
|
3 |
Dr Sailaja Polavarapu |
Others |
Gayatri Vidya Parishad Institute of Health Care and Medical Technology |
Marikavalasa, Visakhapatnam |
|
4 |
Dr. R. Poorani |
Others |
Gayatri Vidya Parishad Institute of Health Care and Medical Technology |
Visakhapatnam |
|
5 |
SINGAMPALLI HARSHA SADGUN & BUSI ANGELINE BHASKAR |
Research Scholar |
DEPARTMENT OF PSYCHOLOGY |
ANDHRA UNIVERSITY |
|
6 |
D.SATYASIVAGANESH |
Assistant Professor |
M.R.COLLEGE(AUTONOMOUS) |
VIZIANAGAARM |
|
7 |
Modi Pavani |
UG Student |
St. Joseph's College for Women |
Visakhapatnam |
|
8 |
G. Likitha |
UG Student |
St. Joseph's College for Women |
Visakhapatnam |
|
9 |
G. Indhu |
UG Student |
St. Joseph's College for Women |
Visakhapatnam |
|
10 |
visakha singh |
UG Student |
St. Joseph's College for Women |
Visakhapatnam |
|
11 |
Reena.P & Sai Sri |
UG Student |
St. Joseph's College for Women |
Visakhapatnam |
|
12 |
D.SATYASIVAGANESH |
Assistant
Professor |
M.R.COLLEGE(AUTONOMOUS) |
VIZIANAGAARM |
|
13 |
KONDA V V S
KRISHNA |
Assistant
Professor |
Government
Polytechnic for Women, Srikakulam |
Srikakulam |
|
14. |
B.
Lakshmi Prasanna Latha, and P. Venkatesu |
Assistant
Professor |
Dr
YSR GDC, |
Vedurukuppam |
Determining the potential of a combination therapy in
hypertensive patients with cardiac comorbidities.
S.M.V Harsha Vardhan and Naga Varshitha
UG Student, Srinivasarao College of Pharmacy,
Visakhapatnam
ABSTRACT
Blood pressure
refers to the force against the walls of the body’s arteries, and major blood
vessels which is exerted by the circulating blood. The main aspect of our study
is to focus on hypertensive patients with comorbid conditions related to
cardiac issues. In this study the effectiveness and safety of three different
treatment approaches were compared and studied which include Amlodipine (alone)
- Medication A, Telmisartan (alone) – Medication T, Combination of both
Amlodipine and Telmisartan– Medication (A+T). The study involves patients
attending cardiology clinics and checking their health progress over a
particular period. The primary goal is
to know about the therapeutic efficacy in reducing the blood pressure by the
medication and also examining potential side effects. The Investigations of the
study found that the treatment with the Combination of Amlodipine(A) +
Telmisartan(T) were much more effective in patients with poorly controlled
hypertension associated with cardiac abnormalities. This study evaluates the
efficacy and safety of combining amlodipine and telmisartan in managing
hypertension in 75 patients admitted to cardiac wards. These results support
the clinical usage of amlodipine and telmisartan as a valuable treatment option
for the patients with Hypertension and associated heart conditions, this
treatment highlights the comprehensive management approaches which helps in
improving patient outcomes and improving their overall cardiovascular health.
KEYWORDS
Hypertension,
comorbid conditions, cardiac issues, amlodipine, telmisartan, therapeutic
efficacy, side effects, combination
Role of AA and its metabolite in
the protection of pancreatic β- cells and improve hyperglycemia induced by
bleomycin
Sailaja Polavarapu1
Poorani Rhenghachar1, Undurti N Das2-3
1Department of Microbiology, Gayatri Vidya Parishad
Institute of Health Care and Medical Technology, Visakhapatnam, India;
2UND Life Sciences, 2221 NW 5th St, Battle Ground,
WA 98604, USA:
3Department of Biotechnology, Indian Institute of
Technology-Hyderabad, Sangareddy,
Telangana, India;
ABSTRACT
Bleomycin (BLM), a widely used
antineoplastic drug, induces pulmonary fibrosis. In addition, it is also known
that bleomycin can cause pancreatic injury. In the current study, we noted that
bleomycin induced apoptosis of Rat Insulinoma (RIN5F) cells can be prevented by
arachidonic acid (AA, 10μg/ml) and lipoxin A4 (LX A4, 1ng/ml, an
anti-inflammatory metabolite of AA. An increase in LXA4 levels was noted when
RIN5F cells were supplemented with AA. Bleomycin induced significant increase
in the fasting blood glucose levels and decreased plasma insulin levels could
be reversed by LXA4. AA and LXA4 improved the antioxidant status and
upregulated anti-inflammatory and anti-apoptotic genes such as IκB and Bcl2.
These results suggest that AA and LXA4 can be employed to prevent
bleomycin-induced dysfunction of pancreatic β cell function.
Protectin DX- an inflammation resolution metabolite
of docosahexaenoic acid, protects against the development of
streptozotocin-induced type 1 and type 2 diabetes mellitus in male Swiss albino mice
Poorani Rhenghachar1,
Sailaja Polavarapu1, and Undurti N. Das2,3
1Department of Microbiology, Gayatri Vidya Parishad
Institute of Healthcare and Medical Technology, Visakhapatnam, India,
2R&D, UND Life Sciences, Battle Ground, WA,
United States,
3Department
of Biotechnology, Indian Institute of Technology-Hyderabad, Sangareddy,
Telangana, India
ABSTARCT
Diabetes mellitus (DM) is common across the globe.
Of the two major types of DM, type 1 and type 2, the latter is more common.
Both type 1 and type 2 DM are associated with inappropriate inflammation,
immune dysfunction and gut dysbiosis. In our efforts to identify other similar
lipid based anti-diabetic molecules, we investigated potential anti-diabetic
action of protectin DX that also has anti-inflammatory and inducer of
inflammation resolution action(s) like LXA4. Protectin DX{10(S)
,17(S)-dihydroxy-4Z,
7Z,11E,13Z,15E,19Z-docosahexaenoic acid, also called as 10(S),17(S) DiHDoHE)}
prevented the development of streptozotocin
induced type 1 and type 2
diabetes mellitus in Swiss male albino mice. Protectin DX showed potent
anti-inflammatory, antioxidant and anti-apoptotic actions that could explain
its anti-diabetic action. The results of the present study showed that protectin
DX can prevent development of both type 1 and type 2 DM in addition to
restoring plasma insulin levels, food and water intake and bodyweight, plasma
levels of IL-6, IL-10, TNF-a; expression of Bcl-2/Bax, iNOS, NF-kB and IkB
genes, balance between pro- and anti-oxidants; OGTT and insulin indices to near
normal. In view of these beneficial actions, efforts need to be developed to
exploit PDX and other similar compounds as potential anti-diabetic molecule in
humans.
Key Words: Diabetes mellitus, Protectin Dx, antioxidant, anti-inflammatory,
anti-diabetic.
Presenter: Dr. R. Poorani
Understanding Proactive
Aggression and Its Association with Internet Gaming
Disorder in Adolescents
S Harsha Sadgun*, B Angeline
Bhaskar1
*Research scholar, Department of psychology,
Andhra university
1MSc
psychology, Department of psychology, Andhra university
ABSTRACT
Internet Gaming Disorder (IGD)
has become a prevalent concern among adolescents worldwide, including in India,
where approximately 19.4% of adolescents exhibit problematic gaming behaviors.
This study investigates the relationship between IGD and proactive aggression
among 845 adolescents in Visakhapatnam, aged 14-21 years, using the Internet
Gaming Disorder Scale - Short Form (IGDS9-SF) and the Reactive-Proactive
Aggression Questionnaire (RPQ). Demographic variables including age, gender,
and education levels were examined for their influence on IGD and aggression.
Results indicated that late adolescents and males showed higher levels of both
IGD and proactive aggression, while middle adolescents exhibited heightened
proactive aggression. Rural and postgraduate students also demonstrated
increased aggression, emphasizing the impact of socio-environmental factors on
behavioral outcomes. The study highlights the need for targeted interventions
to address gaming addiction and aggressive behaviors among adolescents in
diverse socio-cultural contexts.
Keywords:
Adolescents, Aggression, Gaming Addiction, Youth Behavior, Mental Health
EMAIL: harshasadgun5.sh@gmail.com
EMAIL: joypalukurty@gmail.com
RECENT ADVANCES IN CLINICAL
SCIENCES: INNOVATIONS IN DRUG DELIVERY SYSTEMS
Konda V V S Krishna,
Lecturer in Pharmacy, Government
Polytechnic for Women, Srikakulam
ABSTRACT
This review article explores recent advances in
clinical sciences with a focus on innovations in drug delivery systems. The
study aims to provide a comprehensive overview of novel drug delivery methods
including nanoparticles, liposomes, and transdermal patches. Key areas covered
include the mechanisms of drug delivery, targeting strategies, and clinical
applications in treating various diseases. The review also discusses recent
advancements, challenges, and prospects in the field of drug delivery systems.
This synthesis of current knowledge aims to inform and guide future research
and application in pharmaceutical sciences.
Keywords:
Clinical Sciences, Drug Delivery, Nanoparticles, Liposomes, Transdermal Patches
Email:
kondavvskrishna@gmail.com
"Health Impacts and
Long-Term Consequences of COVID-19: A Comprehensive Review"
Sri.
D.Satya Siva Ganesh1,Sri. Anapana Gopal2
, Kum. K.Radha3 ,Sri. S. Nagaraju 4
1 Assistant Professor in
Zoology , Maharajah’s College (Autonomous), Vizianagaram
2
Assistant Professor in Zoology , Maharajah’s College (Autonomous), Vizianagaram
3 Assistant Professor in
Zoology , Maharajah’s College (Autonomous), Vizianagaram
4 Assistant Professor in
Zoology , Maharajah’s College (Autonomous),
Vizianagaram
Mail
Id:mscmscmedsiva@gmail.com
RENAL FUNCTION TESTS ASSOCIATED
WITH KIDNEY DISEASES
G.Likitha 1*
, Dr.
P. Mary Anupama2
1. student of 3rd
B Sc (BBC) , St. Joseph ‘s college For women
2. Head and Asst Prof , Dept .
of Biochemistry , St. Joseph’s College For women (A) , Vsp.
ABSTRACT
Renal function tests are
essential diagnostic tools used to assess the efficiency and health of the
kidneys. These tests provide valuable information about how well the kidneys
are filtering waste from the blood, maintaining electrolyte balance, and
producing hormones crucial for various bodily functions. They are critical in
diagnosing and monitoring a wide range of kidney disorders, from acute kidney
injury to chronic kidney disease. One of the primary tests used to
evaluate kidney function is serum creatinine measurement. Creatinine is a waste
product generated from muscle metabolism and is excreted by the kidneys.
Elevated levels of serum creatinine indicate impaired kidney function because
the kidneys are unable to effectively filter and excrete creatinine from the
blood. Creatinine clearance tests, which involve collecting urine samples over
a specified period, provide a more accurate assessment of kidney function by
calculating the rate at which the kidneys clear creatinine from the blood.
Electrolyte levels (e.g.,
potassium, sodium, bicarbonate) are crucial indicators of kidney function, as
the kidneys maintain electrolyte balance. Abnormalities can indicate kidney
dysfunction. Urinalysis evaluates urine composition, detecting proteinuria
(excess protein in urine), blood cells, or casts (structures formed in kidney
tubules). These abnormalities may signify kidney damage or disease. Renal
function tests are vital for diagnosing kidney disorders, monitoring disease
progression, and guiding treatment. Early detection and intervention can
prevent complications and improve outcomes in kidney disease management.
Key words :- Serum
creatinine, Urinalysis , Electrolyte balance.
*Author for correspondence-
Miss Likhita
Student of 3rd BBC
Mail ID –
garikinalikhita1403@gmail.com
Bacteria Associated with Urine: Diversity, Clinical Relevance, and Future
Directions
G.Indhu1*,
Dr. P. Mary Anupama2*
- Student
of 3rd B.Sc. (BBC), St. Joseph’s college for women
- Head
and Asst. Prof., Dept. of Biochemistry, St. Joseph’s College for Women
(A), Vsp
ABSTRACT
Urine,
traditionally considered sterile, harbours a diverse microbiota influenced by
age, gender, and health status. Recent advances in sequencing technologies have
unveiled a complex ecosystem of bacteria in urine samples, challenging previous
notions of sterility. These bacteria, including both commensals and potential
pathogens, play pivotal roles in urinary tract infections (UTIs) and broader
urological health.
The
primary bacteria found in urine samples from UTI patients include Escherichia
coli (E. coli), Klebsiella pneumoniae, Enterococcus spp., and Proteus
mirabilis. E. coli is the most prevalent, responsible for approximately
80-85% of community-acquired UTIs. It possesses virulence factors such as
fimbriae and toxins that aid in adhesion and invasion of urinary tract
epithelial cells. K. pneumoniae and Enterococcus spp. are also
frequently isolated, contributing to nosocomial UTIs due to their ability to
form biofilms and resist host defences and antibiotics. Antibiotic resistance
is a growing concern in UTIs, with E. coli exhibiting resistance to
commonly prescribed antibiotics like fluoroquinolones and
trimethoprim-sulfamethoxazole. Extended-spectrum beta-lactamase
(ESBL)-producing strains of E. coli and K. pneumoniae further
complicate treatment options, necessitating the use of carbapenems, often
considered last-line antibiotics. Enterococcus spp. are notorious for
intrinsic resistance to many antibiotics, including aminoglycosides and
cephalosporins, posing challenges in therapeutic management. The pathogenesis
of UTIs involves bacterial ascent from the periurethral area to the bladder,
facilitated by factors such as sexual activity, improper hygiene, and urinary
tract abnormalities. Upon colonization of the bladder, bacteria adhere to
urothelial cells and initiate inflammation, leading to the classical symptoms
of UTIs like dysuria, frequency, and urgency. In severe cases, bacteria can
ascend to the kidneys, causing pyelonephritis, which requires prompt medical
intervention to prevent complications such as sepsis and renal damage.
Diagnostic methods for UTIs include urine culture and susceptibility testing,
which guide antibiotic therapy based on identified pathogens and their
resistance profiles. Rapid diagnostic tests like urinary dipsticks are commonly
used in clinical settings for initial screening, although culture remains the
gold standard.n conclusion, understanding the bacterial species associated with
UTIs is crucial for effective diagnosis and treatment. E. coli predominates
as the leading causative agent, while other bacteria like K. pneumoniae and
Enterococcus spp. contribute significantly, particularly in
healthcare-associated infections. Antibiotic resistance poses a substantial
challenge, emphasizing the need for judicious antibiotic use and development of
alternative treatment strategies. Future research should focus on novel
therapeutic approaches and vaccines targeting UTI pathogens to mitigate the
global burden of urinary tract infections.
Keywords
urine microbiota, bacterial diversity, urinary tract infections (UTIs),
molecular diagnostics.
*Author for Correspondence-
Miss G. Indhu
Student of 3rd BBC
Contact Number-
Mail ID:
indhugiduthuri15@gmail.com
Liver function test associated
with liver disease
Vishakha
singh¹*, Dr. M.Padma Sundari²
1.
Student of 3rd B.Sc (BBC), St. Joseph’s college for women
2.Head and Asst. Prof., Dept. Of
Botony ,St. Joseph’s College for Women (A), Vsp
ABSTRACT
Liver function tests (LFTs) are a group of blood
tests that provide valuable information about the state of a patient’s liver.
These tests measure various enzymes, proteins, and substances produced or
processed by the liver. Commonly assessed parameters in LFTs include alanine
aminotransferase (ALT), aspartate aminotransferase (AST), alkaline phosphatase
(ALP), bilirubin, and albumin. Each parameter offers insights into different
aspects of liver health and functionality.ALT and AST are enzymes that help metabolize
amino acids. Elevated levels of these enzymes in the blood often indicate liver
damage or inflammation, as these enzymes are released from damaged liver cells.
While ALT is more specific to the liver, AST is also found in other tissues,
such as the heart and muscles, which can sometimes complicate the
interpretation of AST results.ALP is an enzyme related to the bile ducts, and
high levels can indicate blockages or other issues in the bile ducts, such as
cholestasis. It can also be elevated in bone diseases, so it is important to
interpret ALP levels in conjunction with other liver tests and clinical
information.Bilirubin is a byproduct of the normal breakdown of red blood
cells. The liver processes bilirubin, making it easier for the body to excrete.
Elevated bilirubin levels can lead to jaundice, characterized by yellowing of
the skin and eyes, and may indicate liver dysfunction or hemolysis.Albumin is
the main protein made by the liver and plays a critical role in maintaining
oncotic pressure and transporting hormones, vitamins, and drugs throughout the
body. Low levels of albumin can indicate chronic liver disease, such as
cirrhosis, or other conditions like malnutrition and nephrotic syndrome.
While LFTs provide important information, they are
not definitive on their own. Abnormal results may necessitate further
diagnostic procedures, such as imaging studies (ultrasound, CT scan, MRI) or
liver biopsy, to obtain a more comprehensive understanding of the liver’s
condition.
Key
word : Bilirubin, Amino transferase,
aspartate amino transferase , alkaline phosphatase
*Author for correspondence –
Miss Vishakha
Student of 3rd BBC
Mail Id- vishakha27092002@gmail.com
THE EFFECT OF MALNUTRITION ON HUMAN HEALTH AT VARIOUS STAGES OF LIFE
B.
Lakshmi Prasanna Latha1*, and P. Venkatesu2
1Department
of Zoology, Dr YSR GDC, Vedurukuppam, Chittoor District, A.P-517569
2Department
of Physics, Dr YSR GDC, Vedurukuppam, Chittoor District, A.P-517569
*Corresponding
Author Email: lakshmi73zoology@gmail.com
ABSTRACT
In recent times,
Malnutrition - a widespread worldwide problem, affects people of all ages by
encompassing both under- and overnutrition. Stunting, wasting, and a lack of
certain nutrients are signs of undernutrition, which can lead to diseases like
weaker immune systems, decreased growth, and cognitive impairments. On the
other hand, overnutrition, which results from an excess of calories consumed
and a nutritional imbalance, causes obesity and the health concerns that go
along with it, including diabetes and cardiovascular illnesses.
Malnutrition has many
different causes, such as inadequate food consumption, poor dietary choices,
sociocultural influences, chronic illnesses, and economic inequality. Key
nutritional deficiencies, such as those in vitamins A, D, and minerals like
iron and zinc, are common and have been related to a range of health problems,
including osteoporosis, cardiovascular disease, and cognitive decline. Targeted
interventions are needed to address these deficiencies, such as the use of
fortified foods and educational initiatives to increase access to balanced
diets and improve nutritional awareness.
Aware of the urgency, the
World Health Organization (WHO) has taken steps to improve public health
outcomes by promoting nutritionally enhanced foods and fortification programs,
with a focus on women of reproductive age and vulnerable populations. The significance
of comprehensive health interventions, food security, and adequate nutrition is
emphasized by prevention measures.
In this paper the authors
try to explore the types of nutrition, the role of various nutrients, the
causes of malnutrition across different age groups, its symptoms, and effective
prevention strategies.
Keywords: Malnutrition,
Nutritional deficiencies, Under-nutrition, Overnutrition
Food Sciences and Applied Sciences
|
S.No |
Name of the Participant |
Designation |
Name of the Institution |
Place of the Institute |
|
1 |
Dr. M. Hanumantha Raju |
Assistant Professor |
KRK Government Degree College |
Addanki. Bapatla Dt |
|
2 |
Dr.G.Nagamani & Dr.T.K.Padmaja |
Assistant Professor |
Sri padmavathi women's degree and pg college Tirupathi |
Tirupati |
|
3 |
Dr. P Aruna, Dr. P Vinod Kumar |
Assistant Professor |
Yogi Vemana University |
Department of Food Technology, Vemana Puram, Kadapa-516003 |
|
4 |
Nigama samhitha , Jahnavi and V. Devaki nandini |
PG Student |
Yogi vemana university |
Kadapa Andhra Pradesh |
|
5 |
NAGARAJU.SURARAPU |
Assistant Professor |
MAHARAJA'S AUTONOMOUS
COLLEGE |
Vizianagaram, Andhra
Pradesh |
|
6 |
Dr. Y. Shanti Prabha |
Assistant Professor |
Dr. V S Krishna Government Degree College ( Autonomous) Visakhapatnam |
Visakhapatnam |
|
7 |
Likhitha Yadav. Prakruthi |
Research Scholar |
Gitam (Deemed to be University) |
Visakhapatnam |
|
8 |
B LIKITA SRI & Dr T. Gayatri |
PG Student |
St. JOSEPH COLLEGE FOR WOMEN (A) |
GNANAPURAM, VISHAKAPATNAM |
|
9 |
P.Hani |
UG Student |
St Joseph's College for women |
Visakhapatnam |
|
10 |
Harshitha Chinni |
UG Student |
St.Joseph college for women (A) |
Gnanapuram, convent junction |
|
11 |
B.Dishitha |
UG Student |
St Joseph's College for women |
Visakhapatnam |
|
12 |
B Lakshmi Prasanna Latha |
Assistant Professor |
DrYSRGDC |
Vedurukuppam |
|
13 |
Vadarevu Sony |
Assistant Professor |
St Joseph's College for women |
Visakhapatnam |
|
14. |
V. Prabhakar Rao1, P.
Jeevan Jyothi, L. Md. Bhakshu, B. L. Prasanna Latha, T. Gunasekhar |
Lecturer |
Dr. YSR Government Degree
College |
Vedurukuppam |
|
15. |
|
|
|
|
THE ROLE OF RECENT ADVANCES IN
BIOLOGICAL SCIENCES FOR THE BENEFIT OF THE MANKIND
Dr. M. Hanumantha Raju
Asst. Professor in Zoology, KRK
Govt. Degree College, Addanki.Bapatla District.
ABSTRACT
Biological science is a vast and rapidly advancing
field that encompasses every from the study of microorganisms to the working of
the human body. In recent years, researches have made significant work in
understanding the complex process that govern life, from the genetic code to
the behaviour of ecosystems. Some areas like Genetics and Genomics
Microbiology molecular Biology, Neuroscience, Biotechnology, Bioinformatics,
and Ecology & conservation have been rapidly advances and their studies are
being benefited to the mankind in various aspects. The great Biological
discoveries revolutionized life sciences are Inherence/Evolution (1800s)
Antibiotics (1928), Gel Electrophoresis (1931), Cell discovery (1951), the
structure of DNA (1952), DNA polymerases and restriction enzymes to
recombinant DNA technology and finally to biomedical research and health care.
Developing drugs and Vaccines to prevent the viral infections are also the
recent miracles in the biological field and research. Anyhow more
work has to be done to strengthen the future biological researched and
dedication for the coming generations.
Keywords:
Biosocial studies – previous and
recent – discoveries - benefit for society.
Contact number :Mobile:
94411 30264.
RECENT ADVANCES IN FOOD SCIENCE
AND TECHNOLOGY
Dr. G. Nagamani *, T.K.
Padmaja**, S. Varalakshmi**
*Lecturer, Department of Home
Science, Sri Padmavathi Women’s Degree and PG College Tirupati.
**Lecturer, Department of
Biochemistry, Sri Padmavathi Women’s Degree and PG College Tirupati.,
ABSTRACT
The study aims to present global
challenges such as food security, sustainability, health and quality. It
explores several key areas where significant progress has been made
highlighting cutting edge technologies and their implications for future of
food science. Advances in food processing have enhanced, texture and
nutritional profile of these products, making them more appealing to
consumers. Ensuring food safety and extending shelf life are perennial
challenges in food science. Recent advances include the development of smart
packaging technologies that monitor food freshness and quality. These packages
can detect spoilage and provide real-time information to consumers and
retailers, reducing food waste. Innovations in food preservation techniques, such
as high-pressure processing (HPP) and pulsed electric fields (PEF), have also
improved the safety and shelf life of perishable foods without compromising
their nutritional value and sensory properties.
The
focus on health and wellness has driven the development of functional foods and
nutraceuticals that offer specific health benefits beyond basic nutrition.
Advances in food fortification and enrichment have led to the creation of
products that address nutritional deficiencies and support overall health.
Probiotics, prebiotics, and bioactive compounds are increasingly being
incorporated into foods to promote gut health, boost the immune system, and
prevent chronic diseases. Personalized nutrition, driven by advances in
genomics and metabolomics, is another emerging field that tailors dietary
recommendations to individual genetic profiles and metabolic needs.
Automation and robotics are revolutionizing food processing and manufacturing.
Automated systems and robotic technologies improve efficiency, consistency, and
safety in food production. Advanced food processing techniques, such as
3D food printing, are also gaining momentum, offering new possibilities for
customized food designs and formulations. Reducing the environmental impact of
food production and consumption is a major focus of recent research. The
concept of a circular economy, where waste is minimized, and by-products are
reused, is being increasingly applied in the food industry. Innovations such as
converting food waste into bio plastics, biofuels, and animal feed are gaining
attention. Moreover, sustainable packaging solutions, including edible and
biodegradable packaging, are being developed to address the plastic waste
crisis.
In conclusion, the recent
advances in food science are shaping a more sustainable, healthy, and efficient
food system. By leveraging cutting-edge technologies and innovative practices,
the field is poised to address some of the most pressing global challenges,
ensuring a secure and nutritious food supply for future generations.
Email: ngattupalli@gmail.com
RECENT ADVANCES IN FOOD SCIENCE
AND TECHNOLOGY
Dr. G. Nagamani *, T.K.
Padmaja**, S. Varalakshmi**
*Lecturer, Department of Home
Science, Sri Padmavathi Women’s Degree and PG College Tirupati.
**Lecturer, Department of
Biochemistry, Sri Padmavathi Women’s Degree and PG College Tirupati.,
ABSTRACT
The study aims to present global
challenges such as food security, sustainability, health and quality. It
explores several key areas where significant progress has been made
highlighting cutting edge technologies and their implications for future of
food science. Advances in food processing have enhanced, texture and
nutritional profile of these products, making them more appealing to
consumers. Ensuring food safety and extending shelf life are perennial
challenges in food science. Recent advances include the development of smart
packaging technologies that monitor food freshness and quality. These packages
can detect spoilage and provide real-time information to consumers and
retailers, reducing food waste. Innovations in food preservation techniques, such
as high-pressure processing (HPP) and pulsed electric fields (PEF), have also
improved the safety and shelf life of perishable foods without compromising
their nutritional value and sensory properties.
The
focus on health and wellness has driven the development of functional foods and
nutraceuticals that offer specific health benefits beyond basic nutrition.
Advances in food fortification and enrichment have led to the creation of
products that address nutritional deficiencies and support overall health.
Probiotics, prebiotics, and bioactive compounds are increasingly being
incorporated into foods to promote gut health, boost the immune system, and
prevent chronic diseases. Personalized nutrition, driven by advances in
genomics and metabolomics, is another emerging field that tailors dietary
recommendations to individual genetic profiles and metabolic needs.
Automation and robotics are revolutionizing food processing and manufacturing.
Automated systems and robotic technologies improve efficiency, consistency, and
safety in food production. Advanced food processing techniques, such as
3D food printing, are also gaining momentum, offering new possibilities for
customized food designs and formulations. Reducing the environmental impact of
food production and consumption is a major focus of recent research. The
concept of a circular economy, where waste is minimized, and by-products are
reused, is being increasingly applied in the food industry. Innovations such as
converting food waste into bio plastics, biofuels, and animal feed are gaining
attention. Moreover, sustainable packaging solutions, including edible and
biodegradable packaging, are being developed to address the plastic waste
crisis.
In conclusion, the recent
advances in food science are shaping a more sustainable, healthy, and efficient
food system. By leveraging cutting-edge technologies and innovative practices,
the field is poised to address some of the most pressing global challenges,
ensuring a secure and nutritious food supply for future generations.
Email: ngattupalli@gmail.com
Drying kinetics of bitter gourd rings and their
nutrient composition and physical sensory attributes.
P. Vinod Kumar P. Aruna*,
Yogi Vemana University College, Vemana Puram Kadapa-516003
Corresponding author*Email:pamisettyaruna@gmail.com
Abstract
An
attempt was made to reduce the moisture content by using different dryers in
bitter gourd rings, which contains a unique phyto-constituents. The drying rate
was same for the samples dried in thin layer dryer at 40°C
and in solar tunnel drier. Among the drying methods, the thin layer drying has
high drying rate with less moisture content compared to solar tunnel drier and
sun drier. The drying of samples in thin layer drying at 60°C has taken less time when compared to other
type of driers. The time taken to dry in solar tunnel drier and sun drying is
same but in tunnel drier there is color retention where as in sun drying the
bitter gourd rings appears pale white in color. Sensory attributes were scored
higher in solar drier when compared to other dried samples. The flavour was
good in all types of drying but in sun dried its sour buttermilk. Green color
retention was observed only in the sample dried in solar tunnel drier. In
addition to that, loss of quinine was more in the sun dried sample which results
in the loss of bitterness. The quinine content of sun dried sample is 470.25mg.
The 19.12mg calcium content was found at 40°C
in thin layer drier and solar tunnel drier and vitamin - C of 79.12mg. The
samples dried in thin layer drying at 40°C
is the best method to dry bitter gourd rings because it took less drying time
and scored high in sensory attributes of texture, appearance, colour and
flavor, but solar tunnel drying is the greenhouse method to dry bitter gourd
rings because it doesn’t require input energy as it directly acquires from the
sunlight.
PREPARATION AND STANDARDIZATION OF MORINGA
CANDY
V
DEVAKI NANDINI, P NIGAMA
SAMHITHA , P JAHNAVI
Yogi Vemana University, Kadapa
ABSTRACT
Moringa candy represents a novel confectionery
product that leverages the nutritional benefits of Moringa oleifera, a plant
known for its high content of vitamins, minerals, and antioxidants. V DEVAKI
NANDINI, P NIGAMA SAMHITHA , P JAHNAVI developed this product under the
mentorship of Dr. V RAMA KRISHNA and Dr. P ARUNA . This explores the
potential of moringa candy as a functional food, its health benefits,
production process, and market potential.
Moringa oleifera, commonly known as the drumstick
tree, is renowned for its nutrient-dense leaves, which contain significant
levels of vitamin C, vitamin A, calcium, potassium, and protein. Incorporating
moringa into candy can offer a convenient and palatable way to deliver these
nutrients to a broad audience, including children and adults who may be
reluctant to consume leafy greens.Moringa candy can provide various health
benefits due to its rich nutritional profile. Regular consumption may help
improve immune function, support bone health, enhance skin health, and provide
antioxidant protection. Moreover, moringa’s anti-inflammatory properties can
contribute to overall well-being.The production of moringa candy involves
several steps, including the harvesting and drying of moringa leaves, powdering
the dried leaves, and incorporating the powder into a candy base. The
formulation must ensure that the nutritional integrity of moringa is maintained
while achieving an acceptable taste and texture. Natural sweeteners and flavor
enhancers can be used to improve palatability.
The market for health-oriented confectionery
products is growing, driven by increasing consumer awareness of nutrition and
wellness. Moringa candy can appeal to health-conscious consumers seeking
convenient, nutrient-rich snacks. Effective marketing strategies highlighting
the health benefits and natural ingredients can enhance product acceptance and
market penetration.Moringa candy offers a promising opportunity to combine
health benefits with consumer-friendly confectionery. By harnessing the
nutritional power of moringa, this product can cater to the demand for
functional foods and support better health outcomes. Further research and
development are needed to optimize the formulation and production processes to
ensure product quality and consumer satisfaction.
Author for correspondence-
pasalurijahnavi@gmail.com
Protein Extracts from Stomopneustus
variolaris with antidiabetic potential - a mini review
Dr. Y. Shanti Prabha,
Lecturer in Zoology, Dr. V S Krishna Government
Degree College (Autonomous), VSKP
ABSTRACT
Stomopneustus variolaris, commonly known as the purple sea urchin, has
gained attention in recent years due to its potential in biomedical research,
particularly in the field of diabetes treatment. Researchers have identified
certain protein extracts from this marine organism that exhibit significant
anti-diabetic properties. The anti-diabetic potential of Stomopneustus
variolaris is attributed to specific bioactive compounds found within its
protein extracts. These compounds have been shown to modulate glucose
metabolism, enhance insulin sensitivity, and regulate key enzymes involved in
carbohydrate metabolism. Such properties make them promising candidates for the
development of novel therapeutic agents for diabetes management.
Studies focusing on these
protein extracts have demonstrated their ability to reduce blood glucose levels
in experimental models. This effect is often comparable to or even more potent
than conventional anti-diabetic medications. Moreover, the extracts have shown
additional benefits such as antioxidant activity, which could help mitigate
oxidative stress—a common complication associated with diabetes. The mechanism
behind the anti-diabetic activity of Stomopneustus variolaris extracts
involves interactions with cellular pathways that govern glucose uptake and
utilization. By targeting these pathways, the extracts contribute to improved
glucose homeostasis and overall metabolic health.
Furthermore, the use of marine
organisms like Stomopneustus variolaris for bioactive compound discovery
emphasizes the importance of biodiversity in drug development. Marine
environments offer a vast and relatively unexplored resource of potential
therapeutic agents, including those with anti-diabetic properties. Thus, the
protein extracts from Stomopneustus variolaris show promising potential
as effective anti-diabetic agents. Continued research into their mechanisms of
action, safety profile, and clinical efficacy is crucial for advancing these
extracts toward pharmaceutical development. Harnessing the bioactive compounds
from marine organisms could pave the way for innovative treatments in diabetes
care, offering new hope for patients managing this chronic condition.
Key Words: Stomopneustus, protein
extracts, antidiabetic potential.
Email: shantiprabhay@gmail.com
Comparison
of Physio-functional and Structural characterization
of
Dual-modified tuber starches
Likhitha
Yadav. Prakurthi, G. Sri Harika, Dr.Ch.Koteswara Reddy
Department
of Food Science and Technology, GITAM (Deemed to be University)
ABSTRACT
There
are few studies on the dual alteration of root starches, and none have looked
at the combined action of acetic acid (AA) and ultrasonication. In the present
work, elephant foot yam (EFY) starch, cassava (CS) starch, and sweet potato
(SP) starch were exposed to various time periods of ultrasonication followed by
acetylation, whereas native starches served as controls. Various properties,
including functional, thermal, and morphological, were investigated. Both
treatments enhanced starch's water and oil absorption. AA modification reduced
thermal characteristics as US time increased. Starch morphology indicated
aggregation of individual granules, resulting in surface alterations, pores,
and cracks with AA+US. Acetic acid modification increases crystallinity.
Changes in functional groups detected by FTIR analysis revealed a peak
development (1710-1690 cm-1) related to AA modification. The results
demonstrated that AA+US affected the functionality, morphology, and other
structural properties of SP, EFY, and CS starches, enabling us to utilize the
modified starch in various applications such as confectionery, bread, tablet
binder, and encapsulation.
PREPARATION AND STANDARDIZATION OF MORINGA
CANDY
V
DEVAKI NANDINI, P NIGAMA
SAMHITHA , P JAHNAVI
Yogi Vemana University, Kadapa
ABSTRACT
Moringa candy represents a novel confectionery
product that leverages the nutritional benefits of Moringa oleifera, a plant
known for its high content of vitamins, minerals, and antioxidants. V DEVAKI
NANDINI, P NIGAMA SAMHITHA , P JAHNAVI developed this product under the
mentorship of Dr. V RAMA KRISHNA and Dr. P ARUNA . This explores the
potential of moringa candy as a functional food, its health benefits,
production process, and market potential.
Moringa oleifera, commonly known as the drumstick
tree, is renowned for its nutrient-dense leaves, which contain significant
levels of vitamin C, vitamin A, calcium, potassium, and protein. Incorporating
moringa into candy can offer a convenient and palatable way to deliver these
nutrients to a broad audience, including children and adults who may be
reluctant to consume leafy greens.Moringa candy can provide various health
benefits due to its rich nutritional profile. Regular consumption may help
improve immune function, support bone health, enhance skin health, and provide
antioxidant protection. Moreover, moringa’s anti-inflammatory properties can
contribute to overall well-being.The production of moringa candy involves
several steps, including the harvesting and drying of moringa leaves, powdering
the dried leaves, and incorporating the powder into a candy base. The
formulation must ensure that the nutritional integrity of moringa is maintained
while achieving an acceptable taste and texture. Natural sweeteners and flavor
enhancers can be used to improve palatability.
The market for health-oriented confectionery
products is growing, driven by increasing consumer awareness of nutrition and
wellness. Moringa candy can appeal to health-conscious consumers seeking
convenient, nutrient-rich snacks. Effective marketing strategies highlighting
the health benefits and natural ingredients can enhance product acceptance and
market penetration.Moringa candy offers a promising opportunity to combine
health benefits with consumer-friendly confectionery. By harnessing the
nutritional power of moringa, this product can cater to the demand for
functional foods and support better health outcomes. Further research and
development are needed to optimize the formulation and production processes to
ensure product quality and consumer satisfaction.
Author for correspondence-
pasalurijahnavi@gmail.com
Detection And Identification of
Pest By Using Artificial Intelligence
P.Hani1 K. Jaya Sai
Deepika2
1- BSC.
Agriculture ,St. Joseph’s College for Women(A)
2-Assistant Professor, Department of
Entomology,St. Joseph’s College for women(A)
ABSTRACT
Farmers
are facing unpredictable pest outbreaks due to climate change, increased
international trade of infested materials, and challenges in pest
control. By taking into account factors like natural enemies, economic
thresholds, plant susceptibility, pest biology Detection and Identification of
pest is done with the help of Artificial Intelligence. With the help of
Acoustic sensors, Ultrasonic sensors ,Optical sensors and Image processing
System pest detection and identification is done . Expert staff are crucial in
designing the system, monitoring ecological factors, and making decisions. AI
can significantly enhance sustainable pest management by handling routine tasks
such as monitoring biological and environmental components and determining the
best times and methods for pest control.
Keywords: Artificial
Intelligence, Bio monitoring, Detection, Pest.
Assistant
for Correspondence
P.Hani
Student
of BSC Agriculture
Email:
pinnintihani156@gmail.com
Unveiling The Hidden Power House
Soil Microbes And Their Impact On Plant Health
B.Dishitha 1 D.Tejaswani
1- BSC. Agriculture ,St.
Joseph’s College for Women(A)
2-Assistant Professor, Department of
Agriculture,St. Joseph’s College for women(A)
ABSTRACT
Soil is an essential, finite resource and Earth’s
nutritional reservoir. Microbes drive biological transformations and manage
carbon, macro, and micronutrient pools, facilitating soil and plant- microbe
interactions. In this respect, it harbors very heterogeneous populations
of icroorganisms among which there are bacteria, archaea, and fungi. It
is these microbes that enable sustainable agriculture by replacing fertilizers
and pesticides with environmentally friendly versions. They enhance plant growth
by providing the necessary nutrition, controlling pests in a natural way, and
by stimulating root development.
Keywords:
Macro and Micro nutrients, Plant Microbe interaction, Soil Micro Organisms,
Soil
Health,
Sustainable Agriculture.
Author
of Correspondence:
B
Dishitha
Student
of 3 rd BSC.AGRD
Mail ID:
dishithadishitha28@gmail.com
Pest management by using
Beauvaria bassiana as a Bio-control agent
Harshitha chinni, Jaya Sai Deepika2
1- BSC.
Agriculture ,St. Joseph’s College for Women(A)
2-Assistant Professor, Department of
Entomology,St. Joseph’s College for women(A)
ABSTRACT
Beauveria bassiana is an harshaentomopathogenic
fungus .B.bassiana is widely recognized for its potential in biological pest
control. It acts as an important bio control agent against insect pest. It has
been isolated from an infected Bombyx mori,USA.It as been used as biocontrol
agent due to its ability to infect and kill a wide range of insect
hosts.B.bassiana is very ideal for homopteran pest.B. Bassiana develops a white
muscardine later and infects insects through spore attachment, germination,
cuticle penetration, and internal proliferation, ultimately leading to the
insect’s death. It effectively targets aphids, whiteflies, beetles,
caterpillars, grasshoppers, and termites, among others. The advantages of using
B. bassiana include its eco-friendly nature, specificity to pests, and role in
managing pesticide resistance. And its importance in agriculture for managing
many pest growth. Hereby, we can acknowledge the role of B.bassiana as a
Bio-control control agent for managing different pest species ( mainly,
homopteran pests) without affecting human health.
Key words:
Beauveria bassiana,Bio-control agent,pest, management
Author for correspondence
Miss Harshitha Chinni
Student of 3rd AGRD,
Contact number: 9110541836
Mail id: harshithachinni905@gmail.com
IRON CONTENT OF DEHYDRATED CAULIFLOWER LEAF POWDER
FOR ANAEMIA
Vadarevu Sony1 and Balasasirekha.R2
1 Research
Scholar, Department of Food Science and Nutrition, Avinashilingam Institute for
Home Science and Higher Education for Women,
Coimbatore, Tamil Nadu, India
2Assistant
Professor, Department of Food Science and Nutrition, Avinashilingam Institute
for
Home Science and Higher Education for Women,
Coimbatore, Tamil Nadu, India
1
ABSTRACT
India is
one of the countries which extensively produces cauliflowers in their states,
Still, the population is deficient of micronutrients and causes serious health
deficiencies. Cauliflower (Brassica oleracea)
belongs to Brassicaceae family a Cruciferous seasonal vegetable, grows
extensively, best available and consumed by all socio-economic group with
reasonable price, but the most neglected part of cauliflower is the leaf, usually
the leaf of the cauliflower is discarded as a waste and utilized for animal
feed. The main
objective of the present study is identifying the best method of drying
technique of cauliflower leaf powder and to analyse its macronutrients and
micronutrients. Cauliflower leaves were collected from local farmers and washed
thoroughly with water and applied for different drying techniques which are
sun, shade, roast, oven, cabinet drying to check the iron content. The results
show high iron content is retained in roasted dry method with 30mg/g, and with
lea moisture content of 5.7% and good amount of vitamin C 400mg/100gms. The
research concludes cauliflower leaves is a good source of iron, calcium and
beta carotene, which improves the health quality and prevent from anaemia, thus
incorporation of value-added cauliflower leaves in food can prevent from
deficiencies.
Keyword: Cauliflower Leaves Powder,
Cabinet Drying, Deficiencies
email id : vadarevusony@gmail.com
"A
COMPARATIVE STUDY ON PHYSIOCHEMICAL ATTRIBUTES AND PRODUCT DEVELOPMENT ON
EXTRACTION OF PANEER FROM 5 DIFFERENT BOVINE MILK SAMPLE "
1Dr.
T. Gayatri, 2B. Likita Sri, 3Vadarevu
Sony
1Assistant
Professor, Department of Home Science, St Joseph’s College for Women
(Autonomous), Visakhapatnam, Andhra Pradesh
2
Post Graduate, Food and Nutrition, St Joseph’s College for Women (Autonomous),
Visakhapatnam, Andhra Pradesh
3 Assistant Professor,
Department of Home Science, St Joseph’s College for Women (Autonomous),
Visakhapatnam, Andhra Pradesh
Milk and paneer are excellent sources of protein,
vitamins, and minerals. They contain an array of micro- and macronutrients,
including amino acids, vitamin B12, calcium, magnesium, phosphorus, among
others. In an ideal world, paneer would form a very significant part of our
daily intake if taken in moderation and coupled with a healthy lifestyle.
Paneer, being a complete protein and a probiotic,
in its cooked form, aids easy digestion. In the present study, paneer extracted
from five different bovine milk samples was used: buffalo milk, cow milk,
organic milk, homogenized milk, and pasteurized milk.
For this study, paneers were prepared and
compared to each other based on the recipes developed through these recipes.
The results developed food recipes were evaluated for their sensory attributes
by a panel consisting of 10 members. The results were evaluated.
Milk is a white aqueous solution and an emulsion or
colloid of butterfat globules within a water-based fluid that contains
dissolved carbohydrates and protein aggregates with minerals. It is produced as
a food source for the young, providing energy, the biosynthesis of
non-essential amino acids, essential fatty acids, vitamins and trace elements,
and water. Paneer is a direct acid- and heat-coagulated cheese procured from
milk using a coagulating agent.
Paneer is one of the most common ingredients used
in Indian cooking, more so in North India. In India, 1% of the total milk
production is converted into paneer, with an estimated annual production of
150,000 tons.
In this paper, an attempt has been made to analyse
and compare the yield and nutro-chemical parameters of paneer samples extracted
from five different milk samples. In the present study, the milk samples
selected were cow milk, buffalo milk, organic milk, homogenized milk, and
pasteurized milk.
Nutrient-chemical tests that were estimated
included carbohydrates, proteins, fats, calcium, phosphorus, and total
titratable acid. This comparative analysis shows that the maximum results of
the tests in the present study concluded that the extraction of paneer from
pasteurized milk showed a higher yield than the other milk samples, while
buffalo milk paneer showed a higher content of nutrients in comparison to the
remaining four paneer samples.
Keywords-
Milk, Paneer, Yield & Nutro-Chemical parameters, Study
Unveiling certain synthetic food colorants: Insights into their
chemistry, uses and health implications
V. Prabhakar Rao1*, P. Jeevan
Jyothi2, L. Md. Bhakshu3, B. L. Prasanna Latha4, T. Gunasekhar5
1Lecturer
in Chemistry, Dr. YSR
Government Degree College, Vedurukuppam- 517569, Andhra Pradesh, India
2Principal,
PVKN (A) College, Chittoor- 517001, Andhra Pradesh, India
3Lecturer
in Botany, Dr. YSR
Government Degree College, Vedurukuppam-517569, Andhra Pradesh, India
4Lecturer
in Zoology, Dr. YSR Government Degree College, Vedurukuppam-517569, Andhra Pradesh, India
5Lecturer in Chemistry, S. V. Arts
College, Tirupati-517501, Andhra Pradesh, India
Corresponding author mail id: vipparlaprabhakararao@gmail.com
ABSTRACT
Food colorant is any dye, pigment or substance that imparts color when it is added to food or beverages.
They are added to make food more attractive, appealing, appetizing and
informative. Synthetic food colorants in particular offer several advantages when added to food,
such as consistent coloring, stability under various processing conditions and
cost-effectiveness compared to the natural colorants. They also allow for a
broad spectrum of vibrant colors, which are crucial in maintaining product
uniformity and meeting consumer expectations. However, the health effects of
synthetic food colorants have been a significant concern. Studies have linked
certain colorants to adverse health outcomes, including hyperactivity in
children, allergic reactions and potential carcinogenicity. For instance,
colorants like tartrazine (Yellow 5) and erythrosine (Red 3) have been
associated with behavioral changes and thyroid tumors in animal studies. These
concerns have led to stricter regulations and a growing demand for natural
alternatives. Ongoing research is focused on understanding the long-term health
impacts of synthetic colorants and developing safer, more sustainable
alternatives. There is a need for further research to clarify the mechanisms by
which these colorants affect health, particularly at low exposure levels and to
explore the potential of natural colorants that can provide similar benefits
without adverse effects .
Key
words: Synthetic food colorants,
carcinogenicity, hyperactivity, thyroid tumors.