Conference proceedings for RABS-2024

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Dr. Sr. Shyji PD Principal St. Joseph’s College for Women(A) Gnanapuram, Visakhapatnam

 

 

Dear Esteemed Colleagues,

As the sun rises on this vibrant gathering, we find ourselves at the crossroads of discovery—a place where scientific curiosity converges with innovation. Welcome to the Conference “Recent Advances in Biological Sciences”, where the pulse of life beats in every discussion, every poster, and every shared insight.

Biology, the science of life, has seen a plethora of advancements in recent years, driven by the integration of new technologies and interdisciplinary approaches. These developments are revolutionizing our understanding of life at the molecular, cellular, organismal, and ecosystem levels. Some advancements in the fields of Nanotechnology, Gene editing, Cancer therapy, Tissue Engineering, Microbiome Research have contributed a lot for our better living. Engineered microorganisms are being developed to produce biofuels, pharmaceuticals, and other valuable chemicals more efficiently and sustainably. Synthetic gene networks can perform complex computations and control cellular behaviour, opening up new possibilities in Biochemistry and medicine.

I extend my heartfelt gratitude to the organizers Dr. P. Mary Anupama and Dr. A. Mousami Sankar for organising this National Conference on Biological Science, held at St. Joseph’s College for Women (Autonomous). Their tireless efforts and commitment to advancing scientific knowledge have made this event possible. We appreciate their vision in creating a platform for researchers, academicians, and practitioners to share their latest findings and foster collaboration. I wish this National Conference a great success.

 

(Principal SJCW)

 

 

Dr. K.V. Harish Prashanth, Principal Scientist, Department of Biochemistry, CSIR-Central Food Technological Research Institute (CSIR-CFTRI), Mysuru

 

 

                                                                    Message

It gives me immense pleasure to learn that the Department of Biochemistry, St. Joseph’s College for Women is organising the national conference on the theme “Advances in Biological Sciences” from 26^th to 27^th July 2024.

I would like to congratulate the Organisers for insightful theme symbolising broader spirit behind innovation and transformation experiencing in the field culminating Biochemistry inside Biology.

Biology, the science of life, has seen a plethora of advancements in recent years, driven by the integration of new technologies and interdisciplinary approaches. These developments are revolutionizing our understanding of life at the molecular, cellular, organismal, and ecosystem levels. Some advancements in the fields of Nanotechnology, Gene editing, Cancer therapy, Tissue Engineering, Microbiome Research have contributed a lot for our better living. Engineered microorganisms are being developed to produce biofuels, pharmaceuticals, and other valuable chemicals more efficiently and sustainably. Synthetic gene networks can perform complex computations and control cellular behaviour, opening up new possibilities in Biochemistry and medicine.

          I believe this conference will be a good platform for all the students, researchers, academic faculties, other stakeholders like industrialists and budding entrepreneurs to discuss the current happening in the area of Biological Sciences. I wish all the participants of the conference a fruitful stay and I wish the conference all the success.

         

 

22.07.2024                                                                   (K.V. Harish Prashanth)

Prof. V.S.R.K. Prasad Former & Founder Director, IIPE, Vsp Emeritus Professor, DESAM, AU, Vsp Founder & Life Member, GVP, Vsp Former Chairman, SEAC, AP State. Member of Planning and monitoring committee, Acharya Nagarjuna University

 

 

 

 

 

 

 

 

Biology, the science of life, has seen a plethora of advancements in recent years, driven by the integration of new technologies and interdisciplinary approaches. These developments are revolutionizing our understanding of life at the molecular, cellular, organismal, and ecosystem levels. Some advancements in the fields of Nanotechnology, Gene editing, Cancer therapy, Tissue Engineering, Microbiome Research have contributed a lot for our better living. Engineered microorganisms are being developed to produce biofuels, pharmaceuticals, and other valuable chemicals more efficiently and sustainably. Synthetic gene networks can perform complex computations and control cellular behaviour, opening up new possibilities in Biochemistry and medicine.

I am happy to know that St Joseph’s College for Women, Visakhapatnam is organising a two day national seminar on “Recent Advances In Biological Sciences” on 26^th and 27^th July, 2024. I hope that the deliberations will help the faculty and the participants to update themselves with the recent developments in the field of Biomedical and Biotechnical advances involving the nano-technology for practical applications.

I wish the national seminar a great success and the organisers all the best.

With Best wishes,

VSRK Prasad

 

 

 

Dr P. Mary Anupama Convener and Head Department of Biochemistry St. Joseph’s College for Women(A) Gnanapuram, Visakhapatnam

 

 

Advances in biological sciences refer to significant progress and breakthroughs in understanding life and living organisms at various levels, from molecular to ecosystem. These advancements are often driven by new technologies, methodologies, and interdisciplinary approaches, leading to enhanced knowledge, innovative applications, and improved solutions to complex biological and environmental challenges. Biochemistry is one and only subject, that holds immense potential across various fields due to its comprehensive understanding of the molecular mechanisms that underlie life processes.

The fields that Biochemistry spans allow, elucidating the molecular basis of diseases, leading to the identification of new biomarkers and therapeutic targets. By understanding individual biochemical variations, treatments can be tailored to specific patients, improving efficacy and reducing side effects. Advances in biochemistry have led to the development of biopharmaceuticals, such as monoclonal antibodies and recombinant proteins. Biochemistry contributes to the development of genetically modified crops with enhanced traits such as increased yield, pest resistance, and improved nutritional content. Plant biochemistry can lead to more sustainable farming practices by improving fertilizer efficiency, reducing pesticide use, and developing crops that can thrive in adverse conditions.

          The wide varieties of fields that are ventured as a part of the conference are the allied fields that the subject has contributed to over the decades. Paper presentations on Agricultural Innovations, Clinical Sciences, Bioremediation, Ecosystem management, Industrial productions, Nutrition and health, bioinformatics, Nanoscience’s and Neurosciences.

          Hope the Two Day Conference would help the stake holders enrich their knowledge and continue to make difference in the lives of people.

(Dr P. Mary Anupama)

 

 

 

 

 

 

 

 

 

 

 

 

 

ABSTRACTS OF GUEST SPEAKERS

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Career in Scientific Research: Curiosity & Challenges

 

Dr. K.V. Harish Prashanth,

Department of Biochemistry,

CSIR-Central Food Technological Research Institute, Mysore

harish@cftri.res.in

 

 

Creating a new economy seems an overwhelming task to most of us and obviously no one knows how a future sustainable economy will look like. The role of research in several fields of applied economics, whether related to business or to the economy as a whole, has greatly increased in modern times. Research has its special significance in solving various operational and planning problems of business & industry. Research is equally important for scientists in studying and seeking answers to various social problems too including health. Amidst the same, food biotechnology is a safe and more efficient way to improve crops for overall production and in turn food Industrial growth. Food biotechnology is the latest advancement, building on knowledge gained over the last 10,000 years of plant production. The present talk will be on many areas of food impacts, including farming and the environment; food quality & processing; health & nutrition; and influence of the same in developing nations including India. Further the discussion will be on specific applications which are currently being researched in these areas at ours institute with inculcating young minds for desire to get a research career along with its consequential benefits in intellectual joy of doing some creative work and service to society. Finally, the challenges in solving the unsolved problems, i.e. concern over practical problems which initiates research.

 

 

 

 

 

 

Waste to Energy: Challenges and Prospects

Prof. VSRK Prasad, Founder & Former Director IIPE

The total quantity of Solid waste generated in the country is 160038.9 TPD of which 152749.5 TPD of waste is collected at a collection efficiency of 95.4%. 79956.3 TPD (50 %) of waste is treated and 29427.2 (18.4%) TPD is landfilled. 50655.4 TPD which is 31.7 % of the total waste generated remains un-accounted.

India produces about 450-500 million tonnes of biomass per year.

The total quantum of biomedical waste generation was reported as 774 tons/day of biomedical waste out of which 656 tons/day was non-COVID biomedical waste and 118 tons/day was COVID biomedical waste.

Open air dumping creates unhygienic and poses enormous threat to the people.  It causes aesthetic problem and nuisance due to nauseating pungent odor and promotes spreading of diseases. The situation further gets aggravated by the indiscriminate disposal of Hospital and clinical wastes.  Presence of extremely high level of total and facial coliform pollutes water bodies.  Carbon dioxide and methane produced from solid waste are extremely harmful to the environment.

Bioenergy (a word often used interchangeably with biofuel) is energy derived from biomass, which are plant- and animal-based materials taken from renewable sources. For example, dung, grasses, and wood products were early biofuels that people used to produce energy.

According to government statistics, total estimated energy generation potential from urban and industrial organic waste in India is approximately 5,690 MW.

12.33 lakhs tons of bio mass per day, which can produce 32% of primary energy requirement of the country.

In conclusion, India has tremendous potential for biomass to bioenergy conversion for the production of reliable, cost-effective, and environmentally sustainable bioenergy.

 

Energy by and large is the largest polluting industry either directly or indirectly irrespective of the sources of energy made use of.

Hence it is our responsibility to see that the usage of energy is minimised/optimised in day to day life by each and every citizen, more so the younger generations, such that the pollution is controlled, and more so controlling the raising temperatures of the earth.

 

 

 

 

 

Green synthesis of AgNPs from leaf and callus extracts of Hyptis suaveolens L. and their therapeutic potential

Satyanaryana B, Subhashini Devi P*

*HOD, Department of Biochemistry, AUCST, Andhra University, Visakhpatnam – 530 003

Hyptis suaveolens (Lamiaceae) is a medicinally important herb, commonly known as wilayati tulsi, an indigenous medicinal and aromatic plant. The plant is known to contain several bioactive compounds such as phenols, tannins, saponins, alkaloids, steroids and flavonoids etc. It exhibits anti-rheumatic, anti-cancer, anti-inflammatory, insecticidal and larvicidal activities. Keeping in view of the importance of H. suaveolens, AgNPs were prepared using leaf and callus extracts as synthesis of silver nanoparticles using plant extracts as reducing agents is an environmental friendly and cost-effective approach and their antioxidant and anticancer potentials were evaluated.

Antioxidant potential of L-AgNPs and C-AgNPs were evaluated using Diphenyl Picryl hydrazyl radical scavenging (DPPH), Ferric Reducing Antioxidant Power (FRAP) and reducing power assays. The L-AgNPs showed higher antioxidant potential due to large specific surface area and high fraction of surface atoms and also due to the bioactive molecules which are absorbed on the active surface of silver nanoparticles when compare to C-AgNPs.

Anticancer potential of L-AgNPs and C-AgNPs were evaluated by using MTT, adhesion, matrigel invasion, migration assays and terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay on MDA-MB 231 cell lines. Generally the tumor cell experience alterations in cell to cell and cell to ECM adhesion properties and cellular migration which is the first step in metastasis. Both L- and C-AgNPs treated cells decreased adhesion and migration of MDA-MB 231 tumor cells. Further studies are required to understand the molecular mechanisms of   L-AgNPs and C-AgNPs in combating cancer.

 

 

TOPIC – Food Science & Nutraceuticals

Leela Rani Alla

Director –Lee Pharma Ltd

Introduction

Food science and nutraceuticals play a crucial role in promoting health and well-being. We are what we eat. Food choices reprogram our metabolism and influence our health. In this seminar, we will explore the latest research, innovations, and emerging trends in these fields.

Key Topics

Nutraceuticals & Its Classification:

Nutraceuticals refer to bioactive compounds derived from food sources, often used as supplements. These include vitamins, minerals, and herbal extracts. Literature of recent years emphasizes on redefining the concept of nutraceuticals, taking into consideration the efficacy, safety and toxicity of these products.

Formulation & Standardization of Nutraceuticals:

As it ensures individualized care for patients evidenced based approach is always needed for given intervention and better patient outcome. Creating a method for standardizing nutraceuticals poses challenges due to the diverse nature of these products.

Biochemistry mechanism for nutraceutical formulation for Bone Health: /Therapeutic action of nutraceutical formulation for Bone Health

Bone health is a delicate balance between bone modelling and remodelling, which can be disrupted in various diseases. Imbalance in any of the molecular pathways leads to conditions like osteoporosis. The use of a novel nutraceutical in blend with non-steroidal anti-inflammatory drugs (NSAIDs) has been proven a potential candidate for osteoarthritis, thus improving its efficacy and safety for commercial use.

Quality assurance and Efficacy

Most of the time nutraceuticals are available as over the counter products and therefore should have a strong safety profile and better bioavailability. The most commonly observed issues are contamination, adulteration (inadvertent or intentional) or misleading labels.

 

 

 

 

 

 

Themes- 1. Plant, animal and microbial sciences 2. Bioinformatics, Environmental Sciences and Nano Sciences   3. Poster Presentations 4. Clinical sciences 4.Food Sciences & Applied Sciences

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Plant, Animal and Microbial Sciences

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Oral presentations at seminar Hall

First session- Stream- Plant, Animal and Microbial Sciences Time 1.30 PM

Session Chair persons- Dr V. Sri Devi (ANITS) and Dr. P. Rupa Vani (Govt. Degree college, Vijayanagaram)

S.No	Name of the Participant	Designation	Name of the Institution	Place of the Institute
1	Dr.P.Sachi Devi	Associate Professor	SKR & SKR Government College for Women(A)	Kadapa
2	Archana Kandala	Research Scholar	GITAMS	Visakhapatnam
3	Dr.A.indira Priyadarsini	Assistant Professor	GOVERNMENT DEGREE COLLEGE,NAGARI	NAGARI, CHITTOOR DIST.ANDHRAPRADESH
4	Dr.G.Veda Priya	Associate Professor	Aditya College of Pharmacy	Surampalem, East godavari district
5	Danda Eswar Harsha Vardhan & Dr L. Sujatha	UG Student	Gayatri vidya parishan (MVP campus)	MVP CAMPUS
6	K.Swathi Priya	Associate Professor	Srinivasarao college of pharmacy	Visakhapatnam
7	Gudla Naveena & Dr D. Syamala	UG Student	Gayatri Vidya Parishad	Visakhapatnam
8	Divya Vani Koraganji	Research Scholar	Gandhi Institute of Technology and Management (GITAM)	Rushikonda, Visakhapatnam, Andhrapradesh
9	Namrata Panda	UG Student	St. Joseph's College for Women	Gnanapuram, Visakhapatnam
10	DR.J.NIRMALA	Assistant Professor	CSI BISHOP NREWBIGIN COLLEGE OF EDUCATION	MYALPORE, CHENNAI 4
11	Preethi.M	UG Student	St. Joseph's College for Women	Visakhapatnam
12	Gayatri priya & K. Sarah	UG Student	St. Joseph's College for Women	Visakhapatnam
13	ANAPANA GOPAL	Assistant Professor	Maharajah's College Autonomous	VIZIANAGARAM
14	RADHA KODITHALA	Assistant Professor	MAHARAJAH'S COLLEGE ( AUTONOMOUS),VIANAGARAM	VIZIANAGARAM
15	Bharati Mollety	Assistant Professor & Head	Dr Lankapalli Bullayya College	Visakhapatnam
16	R. CHRISOLITE.CH	Research Scholar	Andhra University	Visakhapatnam
17	ANAPANA GOPAL	Assistant Professor	Maharajah's College Autonomous	VIZIANAGARAM
18	Dr.M.Padma Sundari	Assistant Professor	St. Joseph's. College for women (A)	Visakhapatnam
19	Varshini Beesetty	UG Student	St. Joseph's. College for women (A)	Visakhapatnam
20	Dr. K. Venkata Ratnam	Assistant Professor	Rayalaseema University	Kurnool
21	Dr. P. Rosina George	Assistant Professor	St. Joseph's College for Women (A), Gnanapuram	Visakhapatnam
22	Hanumanthu Thanuja & Landa Urmila	Student	St. Joseph's College for Women (A), Gnanapuram	Visakhapatnam

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

APPLICATION OF AI IN WILDLIFE MONITORING & CONSERVATION-

A REVIEW

APPLICATION OF AI IN WILDLIFE MONITORING & CONSERVATION-A REVIEW

Dr. Sachi Devi. P

Lecturer in Zoology, SKR & SKR Government College for Women (A), Kadapa, A.P., India.

ABSTRACT

Artificial Intelligence (AI) has emerged as a transformative tool in the field of wildlife monitoring and conservation, revolutionizing the way we understand, protect, and manage biodiversity. AI technologies, such as machine learning algorithms and computer vision, are being increasingly utilized to monitor wildlife populations. These systems can analyze vast amounts of data from camera traps, acoustic recordings, and satellite imagery with remarkable accuracy and speed. By automating the identification and classification of species, AI helps researchers track population trends, detect illegal activities like poaching, and assess the health of ecosystems in real-time. Moreover, AI-driven predictive models play a crucial role in habitat monitoring and conservation planning. By analyzing environmental data and species behavior patterns, AI can predict habitat changes, identify conservation hotspots, and optimize resource allocation for conservation efforts. This proactive approach enables conservationists to prioritize interventions effectively and mitigate threats before they escalate. In addition to monitoring and management, AI is advancing our understanding of complex ecological processes. By integrating data from diverse sources and generating insights at scales previously unimaginable, AI facilitates interdisciplinary research and fosters collaboration among scientists, conservationists, and policymakers worldwide. In conclusion, while AI is not a panacea for all conservation challenges, its integration into wildlife monitoring and conservation practices represents a paradigm shift in how we approach conservation science. By leveraging AI's capabilities, we can make informed decisions, implement targeted interventions, and secure a sustainable future for biodiversity on our planet.

Key Words: Artificial Intelligence, wildlife monitoring and conservation, camera traps, acoustic recordings, satellite imagery & sustainable future.

MAIL ID :sachidevipureti@gmail.com

Phytochemical screening, antioxidant, and antifungal activities of Hedysarum tuberosa leaf extract

Divya Vani Koraganji¹, Archana Kandala¹, Prameela Kandra^2*

¹ Department of Biotechnology, GITAM School of  Science, GITAM Deemed to be University, Visakhapatnam-530045, divyavanikoraganji@gmail.com,

^2* Department of Biotechnology, GITAM School of Technology, GITAM Deemed to be University, Visakhapatnam -  530045,  Andhra Pradesh, India. pkandra@gitam.edu,

 

 

ABSTRACT

Medicinal plants can be a potential source of therapeutic compounds that have tremendous applications in the pharmaceutical industry. Due to the presence of various secondary metobolites, medicinal plants are used as a source of many potent drugs.  This study aimed to identify the phytochemical compounds and antioxidant and antifungal activities of Hedysarum tuberosa leaf extract. Phytochemical screening, total phenolic, and flavonoid contents, antimicrobial and antioxidant activities  were determined using standard methods. The hexane extract of  H.tuberosa showed the total phenolic and flavonoid contents (8.64 ± 0.77 mg GAE/g and 0.60 ± 0.06 mg QE/g, respectively). The antioxidant activity against DPPH with IC50 values of 147.89 for H. tuberosa was observed and  showed significant antifungal activity with zone of inhibition 4.7±1.5mm against A. niger respectively. Hence, the leaf parts of H .tuberosa provide a potential source for drug discovery.

 

^*Corresponding author 

Dr. K. PRAMEELA, M. Sc., Ph.D

Associate Professor

Department of Biotechnology 

GITAM School of Technology, GITAM Deemed to be University          

Visakhapatnam - 530 045

Andhra Pradesh, India

E-mail: pkandra@gitam.edu 

Tel: +91-9440311012, 9652672307

 

Bioprospecting: Unlocking Nature's Pharmacy

Dr.A.Indira Priyadarsini^*

^*Lecturer in Botany, Govt.Degree college,Nagari, Chittoor Dist, Andhra pradesh

ABSTRACT

 Bioprospecting, the systematic exploration of natural sources for bioactive compounds, has emerged as a pivotal field in the quest for novel therapeutic agents. This chapter delves into the potential of bioprospecting, highlighting its role in discovering and developing new drugs from natural resources such as plants, fungi, marine organisms, and microorganisms. The natural world, with its immense biodiversity, offers a treasure trove of chemical compounds with unique structures and biological activities. The chapter explores various methodologies, from field expeditions and specimen collection to advanced techniques in chemical analysis and bioassays, showcasing how genomics, metabolomics, and high-throughput screening have accelerated the discovery process.

    Case studies illustrate the translation of natural compounds into clinically approved drugs, emphasizing the importance of interdisciplinary collaboration and the integration of traditional knowledge with modern science. The ethical considerations surrounding bioprospecting, including biodiversity conservation, intellectual property rights, and benefit-sharing with source communities, are critically examined. The chapter also addresses challenges such as the complexity of natural compound extraction and the need for robust regulatory frameworks. By fostering sustainable practices, bioprospecting holds the promise of unlocking new therapeutic avenues and addressing unmet medical needs.

^*Corresponding author mail ID: darshinibharath@gmail.com

 

Exploring the Biological potential of Marine Macroalgae

 

Dr.K.Swathi Priya*, Dr.G.Veda Priya¹

*Associate professor, Srinivasarao College of Pharmacy 

¹Associate professor, Aditya College of Pharmacy

 

ABSTRACT

The present study is to assess the wound healing property of hyroalcoholic extract of marine macroalgae selected from the coastal Andhra Pradesh on diabetes induced  rats. Where the extract is firstly assed for anti-diabetic activity when proven it is associated with diabetic induced wounds. A green macroalgae Spongomorpha indica was collected from coastal area of Visakhapatnam Andhra Pradesh. Hydro alcoholic extract was prepared and it was screened for acute toxicity, anti diabetic. After the antidiabetic activity was confirmed the same extract was estimated for wound healing in the case of diabetes induced rats. The wound healing activity of topical and orally administered hydro alcoholic extracts of spongomorpha indica was investigated by Dexamethasone delayed wound healing model in rats. Dexamethasone is a diabetic and immunosuppressed delayed wound healing model. The spongomorpha indica in Excision wound model showed increased wound contraction area, epithelization period was increased, scar area was decreased and significantly showed increased wound healing effect. In incision model combination of extract plus dexamethasone increased the breaking strength. Hydroxyproline content increased with treated groups compared to Dexamethasone group. Hence the results suggest that hydro alcoholic extracts of Spongomorpha indica showed fast healing effect in infectious wound, immune suppressed and diseased conditions like diabetes.

 

KEYWORDS: Anti diabetic, Streptozocin, Dexamethasone, Glibenclamide, Spongomorpha indica, Wound healing, Hyrdroxypyroline, epithelization.

 

 

Cytotoxic activity of Methanol extract of Chrysanthemum on MCF 7 Cell line

Dr. L. Sujatha¹, Dr. D. Syamala²,D. Eswar Harsha Vardhan³,4. L. Sarath⁴

1.   HOD & Assistant Professor,  Department of Microbiology, GVP college for degree and PG courses (A),  MVP campus, vskp.

2. Assistant Professor,  Department of Microbiology, GVP college for degree and PG courses (A),  MVP campus, Visakhapatnam.

3. & 4. (Student, Department of Microbiology), GVP college for degree and PG courses (A) MVP campus, Visakhapatnam 

 

ABSTRACT 

Chrysanthemum is one of the most widely popular flowers around the world. It is quite widely used for its medicinal properties and antioxidant properties. Chrysanthemum species have been around from the past few thousands of years. It was first originated in China and later spread across the world. It is also widely popular as an ornamental flower.The main aim of the project is to estimate the presence of these chemical compounds in the floral sample and to try to apply these compounds in our daily life for the betterment of our overall health.The plant was air dried and made into a fine powder form and various phytochemical tests are performed, it is estimated that the sample contain carbohydrates, coumarins, flavonoids, tannin and terpenoids.  And other compounds like glycosides, phenols, proteins, saponins, steroids are absent. The crude extract showed increasing antioxidant activity with increasing concentration. It was, however, observed that sample possesses total antioxidant capacity equivalent to 35.61 mg/g ascorbic acid at higher concentration (100 µg/mL). The DPPH assay of the sample shows that antioxidant activity of Sample was observed to be highest activity at 500mg/ml, i.e. 84.24%.Compared to the values published by previous scientists our values are observed to be comparatively higher, it maybe due to plant sample used or the experimentation methods followed. The MTT assay results suggest that the given test sample showed cytotoxic as well as anti-cancer in nature on human breast cancer cells with the low IC50 value of 46.92ug/ml.Due to its rich antioxidants, anti-cancer and other medicinal properties chrysanthemum has wide culinary and medical applications.Future studies should dwelve deeper into the specific bioactive compounds responsible for chrysanthemum's antioxidant effects and explore its potential applications in functional foods, supplements, or herbal formulations and its applications as an organic fertilizer aimed at enhancing human health.

Email: lsujatha@gvpcdpgc.edu.in

 

 

Preliminary Phytochemical Screening and HPTLC studies on Cycas revoluta

Dr.G.Veda Priya* and Dr.K.Swathi Priya¹

*Aditya College of Pharmacy,

¹ Srinivasarao College of Pharmacy,Andhra Pradesh-530003.

 

ABSTRACT

The use of herbal medicinal products and supplements has increased tremendously over the past three decades with not less than 80% of people worldwide relying on them for some part of primary healthcare.However with respect to their active compounds and therapeutic value many medicinal plants from various environments fall under the category of being under explored. In recent years, there has been great demand for plant derived  products in developed countries. These products are increasingly being sought out as medicinal products, nutraceuticals and cosmetics. The present study was carried out to evaluate the phytochemical properties and formulation  of  traditional medicinal plant Cycas revoluta belonging to the family Cycadaceae.The histology of the leaf is performed by taking a transverse section which showed the presence of epidermis, spongy parenchyma, phloem and xylem. The dry powder of the leaves are subjected to fluroscence analysis using UV chamber for the detection of various phytoconstituents.The ethanolic extract of the leaves showed the presence of alkaloids and flavanoids. . HPTLC CAMAG technique is used to detect type of compounds under different chromatographic conditions at 366 nm. Four fluorescent bands were observed at a R_f value of 0.43, 0.47,0.51, 0.74 and the compounds are estimated to be flavanoids or phenolic compounds.Herbal ointment was prepared by mixing accurately measured ethanolic extract of Cycas revoluta to the ointment base by levigating method  to prepare a smooth paste with two or three times its weight of base, gradually incorporating more base until to form homogeneous ointment. The formulated ointment was evaluated by using the parameters like: Physical examination, consistency, solubility, spreadability, irritant effect, PH etc. Finally, the ointment is filled in tubes and was stored at room temperature. Further studies on isolation of  compounds and proven biological activities from these plants will give us a scope which is useful to mankind.

 

Email: gummadi.veda88@gmail.com

 

ANTICANCER ACTIVITY OF METHANOLIC EXTRACTS OF ROSE FLOWER

                                L. Sujatha¹, D. Syamala², G. Naveena³ and G. Gayathri⁴

1.     HOD & Assistant Professor, Department of Microbiology, GVP college for degree and PG courses (A), MVP campus, Visakhapatnam.

2.     Assistant Professor, Department of Microbiology, GVP college for degree and PG courses (A), MVP campus, Visakhapatnam.

3.     & 4. student, Department of Microbiology, GVP college for degree and PG courses (A) MVP campus, Visakhapatnam

 

ABSTRACT

Indian Fragrant rose - Rosa Indica is very popular species and is a symbol of beauty and divinity that possesses astringent, sedative, anti-inflammatory, and antidepressant properties. Its blooms are collected commercially for rose oil, which is used in perfumery, and for its exquisite scent.

In this study rose flowers were carefully collected and air dried to form a fine powder under controlled temperatures. The sample was subjected to Soxhlet extraction using 150ml of methanol as solvent and qualitative phytochemical analysis was done which showed positive results for carbohydrates, coumarins, flavonoids, steroids, tannins, and terpenoids. 

Another affinity-based technique called thin layer chromatography was performed which showed positive result for the presence of flavonoids, terpenoids, steroids and coumarins when observed under ultraviolet light with an Rf value of 0.865, 0.560, 0.447 and 0.373 respectively. 

The crude extract showed increasing anti-oxidant activity with increasing concentration. It was observed that sample possesses total antioxidant capacity equivalent to 45.38mg/g ascorbic acid at higher concentration(100µg/ml). The anti-oxidant activity of Sample (rose flower extract) was observed to increase with increase in the concentration of sample, with highest activity shown at 500mg/ml, 86.2%.

The MTT assay results suggest that the given test sample showed cytotoxic as well as anti-cancer in nature on human breast cancer cells with the IC50 value of 63.5µg/ml.

Keywords: Anti-inflammatory, anti-depressant, Thin layer Chromatography etc.

Phytochemical screening of Calycopteris floribunda leaf extracts

 

Archana Kandala¹, Divya Vani Koraganji² , Prameela Kandra²*

¹Department of Biotechnology, GITAM School of  Science, GITAM Deemed to be University, Visakhapatnam-530045, archana9.kandala@gmail.com,

²* Department of Biotechnology, GITAM School of Technology, GITAM Deemed to be University, Visakhapatnam -  530045,  Andhra Pradesh, India. pkandra@gitam.edu,

 

ABSTRACT 

 

Medicinal plants have been used for centuries together across the world for their therapeutic properties for overall wellbeing and treating specific ailments. On the other hand, despite the latest advancements in medicinal chemistry, Cancer treatment is still unresolved. Medicinal Plants are now a ray of hope for the adjunctive cancer therapies due to their inhibitory effect on growth in Cancer cells. The bioactive compounds present in these plants might potentially inhibit the growth in cancerous cells and induce apoptosis. Calycopteris floribunda, a perennial herb found in the moist deciduous forests of India, is renowned in folk and Ayurvedic medicine. This study focuses on the phytochemical activity of bioactive compounds extracted from the leaves of C. floribunda. Leaf extracts were obtained using Hexane as a solvent through solvent extraction, resulting in pure extracts after 21 cycles. These extracts were then evaluated for their phytochemical activity. 

^*Corresponding author 

Dr. K. PRAMEELA, M. Sc., Ph.D

Associate Professor

Department of Biotechnology 

GITAM School of Technology, GITAM Deemed to be University          

Visakhapatnam – 530 045

Andhra Pradesh, India

E-mail: pkandra@gitam.edu 

Tel: +91-9440311012, +91-9492466554.

 

ISOLATION, IDENTIFICATION AND MOLECULAR CHARACTERIZATION OF SPOILED POTATO

   Namrata Panda^1*, Prerna Nishad^2*, Dr.Jogeswar Gadi³, Dr. P. Rosina George⁴

1 Student of 3rd Bsc (BBC), St. Joseph's College for women

2 Student of 3rd Bsc (BBC), St. Joseph's College for women

            3 CEO & Director of SMDRC LAB 

            4  Assistant Professor, Department of Zoology, St. Joseph's college for women 

 

ABSTRACT

The study is aimed to isolate bacteria present in spoiled potatoes and its molecular characterization is conducted. Samples (visibly spoiled potatoes) were collected from local nearby markets and subjected to microbial isolation using standard culture techniques. Multiple bacterial colonies were obtained and cultured. Morphological, Biochemical tests and molecular analysis were conducted to identify the isolates. Morphological characterization involved gram staining and biochemical tests included antibiotic sensitivity assay. For Molecular characterization universal bacterial primer that is 16s rRNA primer (Forward -5’AGAGTTTGTCHYGGYTYAG 3’ and Reverse - 5’ ACGGCTACCTTGTTTACGACT 3’) gene sequencing was employed. DNA was extracted from bacterial culture, and the 16s rRNA gene was amplified using polymerase chain reaction (PCR).The amplified products were sequenced and compared with known sequence in Database using BLAST Tool to identify the bacterial isolate. The Acinetobacter strain was found along with other bacterial species in our samples. This was found to be gram -ve strain. This is further confirmed by gram staining after sequencing. The Acinetobacter strain was found to be resistant to the antibiotics we used (ampicillin, streptomycin, tetracycline & kanamycin).This highlights the microbial diversity in spoiled potatoes and provides insights into potential spoilage mechanisms. Understanding these bacteria can inform better storage and preservation as well as safety control strategies to minimize potato spoilage and economic losses.

Keywords: spoiled potato, microbial isolation, bacterial culture, gram staining, PCR, antibiotic sensitivity, BLAST tool, spoilage mechanisms.  

* Author for Correspondence-

Miss Namrata Panda

& Miss Prerna Nishad

Student of 3rd BBC

Contact Number-

Mail id- namratapanda1718@gmail.com

prernan418@gmail.com

ExtractionandCharacterizationofSilverNanoParticlesSynthesizedUsing Plant Extract of Kedrostis foeditissima (jacq). Lin

 

Dr.J.Nirmala¹*and Dr.R.Pandian²

¹DepartmentofPlantBiologyandPlantBiotechnology, Presidency College, (Autonomous) Chennai, India

²UniversityofMadras,CSIRCLRI Department of Bio technology, Tamilnadu, India

*Corresponding author

 

ABSTRACT

Nanotechnology is emerging as a rapidly growing field with is applicationin science and technology for the purpose of manufacturing new materials at the nanoscale level. The recent development and implementation of new technologies have led to new era, the nanoparticle of bio molecules in plants can acts as capping and reducingagents and they have investigated in order to find an eco-friendly techniques for production of well characterized .the present investigation was carried out to green synthesis of Agno³ nano particle s by using the medicinal plant of Kedrostisfeotidissima. They weresynthesized by mixing aqueous extracts and 1mM of agno³, the formation of nanopaticles was monitored by visualizing color changes and it was confirmed by UV-vis spectrophotometer, FTIR, XRD, SEM the result of various techniques confirmed the presence Agno³ nanoparticls.

 

Keywords   K.foeditissima,UV,FTIR, XRD, EDAX, SEM

 

ISOLATION, IDENTIFICATION AND MOLECULAR CHARACTERIZATION OF BACTERIA FROM SEA WATER  

Sarah^1*, Dr. P. SARADA²

1.Student of 3^rd B.Sc (BBC), St. Joseph’s College for Women (A)

 2.Head of Dept. of chemistry, St. Joseph’s College for Women (A), Visakhapatnam 

 

ABSTRACT 

The study is aimed to isolate bacteria present in sea water and its molecular characterization is conducted. Sea water sample was collected from sea shore and subjected to microbial isolation using standard culture techniques. Multiple bacterial colonies were obtained and cultured. Morphological, Biochemical tests and molecular analysis were conducted to identify the isolates. Morphological characterization involved gram staining and biochemical tests included antibiotic sensitivity assay for  Molecular characterization. universal bacterial primer that is 16s rRNA primer (Forward -5’AGAGTTTGTCHYGGYTYAG 3’ and Reverse – 5’ ACGGCTACCTTGTTTACGACT 3’) gene sequencing was employed. DNA was extracted from bacterial culture, and the 16s rRNA gene was amplified using polymerase chain reaction (PCR).The amplified products were sequenced and compared with known sequence in Database using BLAST Tool to identify the bacterial isolate. The Enterobacter cloacae strain and Vibrio alginolyticus strain was found along with other bacterial species in our sample. These were  found to be gram -ve strain. This is further confirmed by gram staining after sequencing. Antibiotic sensitivity assay test was performed. Vibrio alginolyticus bacterial species are resistant to ampicillin , kanamycin, streptomycin and tetracycline where as Enterobacter Cloacae species are susceptible to kanamycin, streptomycin and tetracycline. Usually the two bacterial species identified as Enterobacter cloacae and Vibrio alginolyticus are pathogenic to human health . The bacterial population increases in Sea due to contamination and discharging of wastes directly into the water bodies . It is Advisable to not to discharge the wastes directly into the water bodies so as to decrease the Contamination level in the sea . It is concluded that the bacterial strains identified will be Helpful to humans in biodegradation.

Keywords:  sea water, microbial isolation, bacterial colonies , bacterial culture, molecular analysis ,  gram staining , molecular characterization, PCR, antibiotic sensitivity, BLAST tool, contamination, bacterial strains, gram -ve bacteria, Enterobacter cloacae, Vibrio alginolyticus.

*Author for Correspondence- 

Miss  Sarah 

Student of 3^rd BBC

Contact Number- 

Mail ID: sarah2703004@gmail.com

 

Toxicity Evaluation, Behavioral and Haematological Studies of Azaxistrobin on Ctenopharyngodon idella (A Freshwater Grass Carp fish)

Anapana gopal¹, Venkata rathnamma V², DSS Ganesh³, Nagaraju surarapu⁴

1,3,4 – Department of Zoology, Maharajah’s College (Autonomous), Vizianagaram.
2 – Professor, Department of Zoology & Aquaculture, Acharya Nagarjuna University, Guntur.

 

ABSTRACT

In this study, the acute toxicity of Azoxystrobin, a fungicide, was assessed in Grass Carp (Ctenopharyngodon idella) over 24, 48, 72, and 96-hour intervals at concentrations ranging from 11 mg/l to 17 mg/l. Behavioral and hematological responses were evaluated to gauge the physiological impacts of Azoxystrobin exposure. Behavioral changes such as increased respiration rate and altered swimming patterns were observed, along with morphological indicators like enhanced mucous secretion. The toxicity of Azoxystrobin was found to be both time- and dose-dependent, with significant mortality and hematological alterations noted at higher concentrations. These findings underscore the potential risks Azoxystrobin poses to freshwater ecosystems, highlighting the need for further research to understand its environmental impacts and regulatory implications. Limitations included the study's confinement to laboratory settings and specific endpoints, cautioning against direct extrapolation to natural environments or long-term exposures. This research advances knowledge of Azoxystrobin's effects on freshwater fish and underscores its role as a bioindicator in environmental monitoring studies.

Key words: Azoxystrobin, toxicity, freshwater fish, Ctenopharyngodon idella, behavioral changes, hematological studies.

 

Corresponding author: Anapana Gopal.    
Corresponding authors mail I’d: gopalzoology@gmail.com

 

 

 

 

A STUDY ON THE IMPACT OF BACTERIAL DISEASES AND MANAGEMENT PRACTICES IN   PENAEUS MONODON AT CHINTAPALLI REGION, VIZIANAGARAM DISTRICT, ANDHRA PRADESH, INDIA

 

Kum. K.Radha¹,Sri. S. Nagaraju² , Sri. D.Satya Siva Ganesh³ ,Sri. Anapana Gopal ⁴

1  Assistant Professor in Zoology , Maharajah’s College (Autonomous), Vizianagaram 

 2 Assistant Professor in Zoology , Maharajah’s College (Autonomous), Vizianagaram 

 3  Assistant Professor in Zoology , Maharajah’s College (Autonomous), Vizianagaram   

 4   Maharajah’s College (Autonomous), Vizianagaram

 

Abstract

Andhra Pradesh stands top in the aquaculture production in India and shrimp farming is one of the major sources of income. Now-a-days shrimp culture is facing many problems among them disease mitigation became major issue for the shrimp farmers. A study was done to evaluate the diseases affecting Penaeus monodon farming in a coastal region of Vizianagaram district of Andhra Pradesh, i.e., Chintapalli Coastal region.Mostle the diseases that are responsible for huge losses in Penaeus monodon culture is found to be White Spot Syndrome Virus (WSSV), White Faecal Syndrome (WFS), Black Gill Disease (BGD), Loose Shell Syndrome (LSS), Running Mortality Syndrome (RMS), and Enterocytozoon Hepatopenaei (EHP) of various coastal regions of Andhra Pradesh.In this,Chintapalli Coastal region in Vizianagaram district of the Andhra Pradesh was selected for the identification prevailing diseases,causative agents, Dissolved Oxygen(D.O) problems and implementation of biosecurity measures . It is observed that, more disease related problems observed during the summer crop in this area.Therefore it is suggested that by practicing better management practices (BMP) by necessary biosecurity measures to prevent these diseases.

Keywords:Andhra Pradesh,BMP practices,diseases,Penaeus monodon

 

Mail Id:radhakodithala49@gmail.com

 

A Salt-tolerant Bacillus species,  Promising Rhizobacteria to Mitigate Salinity Stress in Rice and Black gram plants

Bharati Mollety^1,  

¹ Assistant Professor & HOD, Dept of Biotechnology(UG), Dr Lankapalli Bullayya College,Visakhapatnam, INDIA

ABSTRACT

Bacillus species have show strong persistence to almost all abiotic stresses because of their superior metabolic/genomic background and capacity for spore formation. Thus, The endophytic rhizobacteria in association with plants  involve in improving plant's tolerance and enhancing the fertility of soil. This work aimed to assess the diversity of cultivable salt-tolerant Bacillus species in pneumatophores from mangroves Avicennia alba,  Exochoria agalocha and Acanthus ilicifolius(.L). halophytic roots from Suaeda nudiflora  and Suaeda monoica , Acanthus ilicheniformis, grown in and around CORINGA WILDLIFE SANCTUARY, ANDHRA PRADESH, INDIA. Based on morphological and Biochemical tests twenty -seven bacillus strains were isolated and performed plant growth promoting traits like Temperature tolerance, Salinity Tolerance,  Plant growth Promoting hormone IAA synthesis, Siderophore synthesis, Phosphate solubilisation, Amylase, Protease & Carboxylase production, Chitinase production, And the most potent salt-tolerant Bacillus strains was identified on the basis of molecular analysis of 16s r-RNA sequencing. And, conducted a pot experiment to evaluate its potential as a substitute to lessen the detrimental effects of saline soils on black gram and rice plants.    

Corresponding Author: Email id: molletybharati@gmail.com

Studies on production of pharmaceutically important secondary metabolites using hairy root cultures of Indian sarasaparilla Hemidesmus indicus (L) R.Br. 

R.Chrisolite. Ch., Dr. P. Subhashini Devi

Biochemistry, Andhra University, Visakhapatnam

 

ABSTRACT

Hemidesmus indicus is common Indian medicinal plant widely used in Ayurvedic, unani, homeopathic medicines. From ancient times Hemidesmus indicus is used in folk medicines to cure diseases. In traditional Indian system of medicine it is widely used as blood purifier, diuretic, anti-rheumatic and anti-diarrheal agent and also possess anti-viper venom activity. It is also known to possess activity against skin diseases, asthma, bronchitis, epileptic fits in children and 'tridosha' diseases of the blood leukarea  kapha and vata. It is also used as flavouring agent for the preparation of soft drinks and bakery products and as perfumery in cosmetic industry. It contains various phytochemical constituents belonging to the category glycosides, flavonoids, tannins, saponins, sterols and volatile oils. The multiple uses of this plant species has led to the indiscriminate collection from its known habitats and consequent scarcity in the supply of raw materials for the traditional herbal drug industry.  The scarcity of the genuine raw material in nature has forced the drug makers to use other species roots. As it is a deep rooted plant harvesting of the roots from the field with sparse distribution of the plant is labour intensive and uneconomic. Since the plant is rich source of various secondary metabolites and scarcity of the supply of raw materials. It deserves research endeavour for establishing tissue culture protocol towards their conservation and also production of secondary metabolites using hairy root cultures through gene transfer techniques.

Keywords: 

Hemidesmus indicus, Nodal explants, In vitro regeneration, secondary metabolites, Agrobacterum rhizogens, Gene transformation, Hairy roots, rol primers,  HPLC, purification, In vitro cytotoxicity.

 

Fungal elicitors Alternaria sesami enhanced biosynthesis of antioxidant compounds in callus cultures of Sesamum indicum L

Dr.M.Padma Sundari

Assistant Professor (Botany)St.Joseph’s College for Women(A), VSKP

 

ABSTRACT

Sesamum indium L., belonging to the Pedaliaceae family is an important oil seed crop of the world. Phytochemical investigation of Sesami has revealed the presence of biologically active compounds namely lignans glucoside . It is known that several lignin compounds and phenolic compounds have potent antioxidant properties (Osawa & Naimiki, 1981; Osawa, 1985). It is considered that these compounds play an important role in preventing oxidative damage in Sesami seeds. Elicitation is the induction of secondary metabolites production by either biotic or abiotic treatments. The use of pathogenic fungal preparations as elicitors has become one of the most important and successful strategy to improve secondary metabolites production in plants cell culture. The objective of this research was to develop phytochemical production from Sesamum indicum L  from callus culture after exposure to biological elicitors (Alternaria sesami and Cercospora sesami) for eventual medical usage, to analyze these potential medicinal metabolites.The methods used include plant tissue culture and biochemical analysis.  First, the callus cultures were developed from different explants (hypocotyls and coteleydons). After the callus culture was developed, it was treated with different concentration of biotic mycelial extracts and their effects on callus growth and phenolic production were assessed. To identify and quantify the phenolic compounds in the callus, the total phenolics were extracted and assayed by Folin-Ciocalteau method and the radical scavenging behaviour was assayed by DPPH (diphenyl-1-picrylhydrazyl) system.

In Alternaria sesami treated cotyledonary callus, the total phenolic content increased in the first two weeks for all four concentrations but decreased in the third week and increased slightly in the fourth week except for 1.0 % treated callus.

Hypocotyl callus of Alternaria sesami treatments showed variation in total phenolic production with Alternaria treated extracts, the total phenolic content increased up to the first two weeks and decreased in the third and fourth week.When compared to the controls, sesamin production was enhanced to 1-3 folds in all treatment except in 0.5 % concentration of cotyledonary callus where in the third week the sesamin production was similar to the controls. Thus, elicitors treated callus response increased phenolic compounds to that of the control. The 2,2-diphenyl-picryhydrazyl ( DPPH) activity is a proper indicator for investigating the free radical scavenging activities of phenolic compounds  when Sesamum indicum L. hypocotyl and cotyledon callus were cultured with 0.5 % - 2.0 % concentration of mycelial extracts of both fungi.           With Alternaria mycelial extract, maximum activity was observed at 0.5 % in the first week of treatment (30.43 µg/ml) and from the second week onwards, the free radical scavenging activity decreased in succeeding weeks in the hypocotyl callus.

 

Key Words: Sesamum indicum L.,Elicitor ,Callus culture, Antioxidants.

MAIL ID: mail:mpadmas13@gmail.com

First occurrence of larval Eustrongylides (Nematoda: Dioctophymidae) in freshwater fish Channa punctatus in Visakhapatnam, A.P India.

Dr. P. Rosina George

Assistant Professor in Zoology, St. Joseph’s College for Women (A), Visakhapatnam, India

9948822398

*rosina.rovic@gmail.com    ORCID ID 0000-0002-2448-6768

ABSTRACT

Nematodes from the genus Eustrongylides infect freshwater habitats' resident fish species and fish-eating birds. The intake of raw or undercooked fish exposes a person to nematodes from the genus Eustrongylides, which are potentially harmful to humans. Twenty-five specimens of Channa punctatus were caught from different fish markets from Visakhapatnam for parasitological examination (2009). The presence of three different Eustrongylides sp larva in the intestine was revealed in five fish. This finding represents the first determination of the larvae in the Channa punctatus in Visakhapatnam. The prevalence of the parasite was 20%.

Keywords: Eustrongylides; Nematodes; Channa punctatus; Visakhapatnam

 

                                  

Effective treatments for breaking dormancy in mung bean ( Vigna radiata) seeds  

        1. Hanumanthu Thanuja, BSc Agriculture and Rural development 

          St Joseph college for women.(A).

      2.   Landa Urmila, Assistant professor, Department of Seed science and technology 

         Mail id: urmila.landa31@ gmail.com,   St Joseph college for women (A).

                        

                                              ABSTRACT 

        Seed dormancy is a condition in which seed is unable to germinate even under ideal conditions. The causes of dormancy include hard seed coat, under developed embryo, lack of supply of enzymes, chemical inhibitors. Some of the effective treatments we conducted on mung bean variety  WGG-42 in laboratory.  An experiment was conducted in a completely randomized design with four replications. Green gram seeds are treated with Gibberellic acid 3,hot water treatment, prechilling treatment,  and non treated seeds. Green gram  seeds are soaked in GA3 of 100 ppm for 8 hours ,pre chilling treatment with  7° c for 5 days,hot  water treatment seeds are soaked in 80°c for 5minutes. Seed germination and growth parameters were recorded The highest germination percentage    95% , root length (10.05cm ), shoot length (17.05cm) was observed in GA3 of 100 ppm soaked seeds for 8 hrs followed by  pre chilling treatment  7° c  for 5 days .where as the lowest found in non treated seeds. 

Key words: Dormancy , Gibberellic acid, Pre- chilling, Scarification, Stratification 

 

Author for correspondence: 

Miss Hanumanthu Thanuja 

Student of 3rdAGRD 

Contact no: 9959422119

Mail id: hanumanthuthanuja@gmail.com

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Bioinformatics, Environmental Sciences and Nano Sciences

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

S.No	Name of the Participant	Designation	Name of the Institution	Place of the Institute
1	K. Nischala Deepthi	Research Scholar	GITAM University	Rushikonda
2	Abhishek Kumar Verma	Research Scholar	Manipal University Jaipur	Jaipur, Rajasthan
3	Dr. P.K.PRAVEEN KUMAR	Professor	Sri Venkateswara College of Engineering	Sriperumbudur, Tamilnadu
4	Rahul Karra	Research Scholar	GITAM University	VIZAG
5	Dr.P.Padmavathi	Associate Professor	Sri Padmavathi Women's Degee and PG College,Tirupathi	Tirupati
6	HARIKA Allamsetty	Research Scholar	SDMSMK, Vijayawada	Vijayawada
7	Dr.Pallavi Atmuri	Assistant Professor	SDMSMK	Vijayawada
8	Anshika Upadhyay	UG Student	st joseph's college for women	Visakhapatnam
9	Dr L MAHMMAD BHAKSHU	Assistant Professor	Dr YSR Government Degree College	Vedurukuppam, Chittoor (Dt) A.P. 517569
10

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Exploring Plant Compounds (Centella asitica) Interactions with Streptococcus mutans Drug Targets

 

K. Nischala Deepthi¹ and Dr. A. Krishna Chaitanya²

¹Department of Biochemistry, TSR & TBK College, Visakhapatnam.

²Department of Life Sciences, School of Science, GITAM Deemed to be University, Visakhapatnam-530045, Andhra Pradesh, India.

 

ABSTARCT

Dental caries is said to be a common chronic disorder distributed worldwide. It is estimated that globally, 2 billion people suffer from caries. It is defined as a bacterial disease of calcified tissues of teeth, which is characterized by demineralization. Demineralization is caused by several pathogenic microorganisms in which Streptococcus mutans play a vital role as it promotes biofilm formation, acid tolerance, and carbohydrate metabolism. The current study aims to evaluate interactions between the 13 plant compounds of Centella asitica targeting the proteins of S. mutans. Centella asitica has been proven to possess potential phytochemicals and it has been utilized as a medicinal drug in treating several diseases. The methodology includes identifying plant compounds and drug targets of S. mutans from the literature. The 13 compound details were obtained using PubChem and subjected to Lipinski rule for drug-likeness and ADMET properties prediction using Swiss ADME. Based on the best properties, 6 compounds were selected for further docking studies. Uniprot and PDB were used to obtain the molecular function and 3D structures of the 14 target proteins of S. mutans, out of which two were identified as potential targets. Ligand-receptor docking was done using the Swiss-Dock tool. The docking studies revealed that the dodecanoic acid out of 6 selected compounds showed good binding; hence, it could act as a potential ligand on which further studies needed to be carried out.

 

Keywords: 

Dental caries, Demineralization, S. mutans, ADMET properties, Docking

 

 

“Unveiling Promising Antituburcular Candidates: A Multi-Database Exploration through Integrated Structure and Ligand based Pharmacophore-Based Screening and Molecular Dynamics Simulation of NadD Inhibitors”

Abhishek Kumar Verma¹ and Sandeep Kumar Srivastava^1*

¹Structural Biology & Bioinformatics Laboratory, Department of Biosciences, Manipal University Jaipur, Jaipur, Rajasthan 303007, India

 

ABSTRACT

The tuberculosis (TB) epidemic continues despite concerted efforts, which means new treatment approaches must be investigated. MtbNadD has emerged as a potential target for latent and active tuberculosis, according to recent studies. We describe a pharmacophore-based virtual screening methodology in this work to find putative MtbNadD inhibitors. Molecular docking, which focuses on the NADP binding pocket of NadD, identified a number of compounds with robust and significant binding affinities. These highly rated inhibitors show potential for additional research and development as antituburcular drugs, which could provide a fresh approach to treating tuberculosis. Strong binding and interactions were seen between Pharm20, which came from structure-based pharmacophore modeling, and Pharm25, Pharm34, Pharm35, Pharm46, and Pharm52, which came from ligand-based pharmacophore modeling, with important active amino acids in the MtbNadD structure. Their effectiveness was also confirmed by evaluation utilizing 200 ns MD simulations, with particular attention on the final 25 ns trajectory for MMPBSA estimates. MD simulations confirmed that the inhibitors were able to adjust and form stable complexes within of NadD's binding pocket. Additionally, the significantly low binding energies from MMPBSA analyses highlighted the important interactions with the active amino acids of NadD. As a result, Pharm20, Pharm25, Pharm34, Pharm35, Pharm46, and Pharm52—the compounds that were found—have a great deal of potential to develop a new class of antimicrobial inhibitors that are especially designed to fight tuberculosis, which might completely alter how the disease is treated.

Keywords: Mycobacterium tuberculosis; NAD Biogenesis; NadD; Structure-based pharmacophore modeling; Ligand-based pharmacophore modeling; Virtual screening; Drug discovery

Email: sandeepkumar.srivastava@jaipur.manipal.edu

 

 

 

HSP90 isoforms – important targets for Liver Fibrosis

 

Dr. P.K.Praveen Kumar^*

*Professor, Department of Biotechnology, Sri Venkateswara College of Engineering, Pennalur, Sriperumbudur Tk – 602117, TN, India

 

ABSTRACT

 

Liver fibrosis is a condition where there is excessive accumulation of scar tissue (fibrous tissue) in the liver and it is the intermediate stage of Hepatocellular carcinoma, a primary liver cancer. This fibrous tissue replaces normal liver tissue and disrupts the structure and function of the liver. It is typically a response to chronic liver injury from various causes, such as: Alcohol abuse, Non-alcoholic Fatty Liver Disease (NAFLD), Non-alcoholic Steatohepatitis (NASH), Chronic viral hepatitis, biliary tract disorders and Autoimmune hepatitis. Heat Shock Protein 90 (HSP90) and mitochondrial HSP90, also referred to as TRAP1 are important critical chaperone target receptors for early diagnosis and targeting Liver Fibrosis. Both HSP90 and TRAP1 expression was found to be higher in liver fibrosis patients. Hence, the importance of HSP90 and TRAP1 inhibitors mechanism and mitochondrial targeted delivery of those inhibitors function are widely studied. This review also focuses on importance of protein–protein interactions of HSP90 and TRAP1 targets and association of its interacting proteins in various pathways of HCC. To further elucidate the mechanism, systems biology approaches and computational biology approach studies are well explored in the association of inhibition of herbal plant molecules with HSP90 and its mitochondrial type in Fibrosis.

Keywords: Fibrosis, HSP90, TRAP1, Non-alcoholic Fatty Liver Disease (NAFLD), Non-alcoholic Steatohepatitis (NASH).

 

 

 

 

 

WATER USE EFFICIENCY STUDIES ON KALESHWARAM LIFT IRRIGATION PROJECT

Rahul Karra ¹, M. Kiranmai Reddy²

¹Research Scholar, Department of Environmental Sciences, School of Science, Gandhi Institute of Technology and Management (GITAM – Deemed to be University)

 

²Associate Professor, Department of Environmental Sciences, School of Science, Gandhi Institute of Technology and Management (GITAM – Deemed to be University).

 

Abstract 

The Kaleshwaram Lift Irrigation Project (KLIP) is a massive undertaking in Telangana, India, aiming to provide water security to millions. However, water use efficiency (WUE) is crucial for the project's long-term sustainability. This paper examines existing studies on WUE in the context of KLIP. It analyzes factors impacting WUE, including canal seepage losses, on-farm practices, and crop selection. The paper further explores potential strategies to enhance WUE, such as canal lining, precision irrigation techniques, and promoting water-efficient crops. Finally, it identifies areas for further research to optimize water use within KLIP. The Kaleshwaram Lift Irrigation Project (KLIP) in Telangana, India, stands as a monumental undertaking aiming to revolutionize agriculture across 14 districts. With ambitions to irrigate over 18.5 lakh hectares of land by diverting water from the Godavari River, KLIP represents a significant leap towards achieving water security for millions. However, amidst the promise lies a crucial challenge: ensuring optimal water use efficiency (WUE) for the project's long-term sustainability. India faces a burgeoning water crisis. The World Resources Institute classifies India as "high-risk" in terms of water stress, with per capita water availability falling drastically from 1,545 cubic meters in 2000 to a mere 1,173 cubic meters in 2017 .  In this context, KLIP's success hinges on its ability to deliver irrigation water without exacerbating existing water scarcity concerns. This paper delves into the critical issue of WUE in the context of KLIP.

 

Keywords– Kaleshwaram Lift Irrigation Project (KLIP), Water Use Efficiency, Irrigation Management, Canal Seepage, On-farm Practices, Precision Irrigation

 

 

Understanding Interactions and Promoting Sustainable Environment.

Dr P Padmavathi
Department of chemistry , SPW Degree and PG College, Tirupati.

Abstract

Environmental science integrates various disciplines to study the relation between human beings and their surroundings, includes eco system, pollution control, resource management, and sustainability. This abstract explores all the areas concerned with chemical and biological surroundings in which the organisms live. The prominent global problems such as climatic changes, biodiversity loss, and pollution are discussed, reinforcing the necessity for ingenious answers and universal cooperation. Environmentalists use scientific principles to inform policies and practices that increase environmental health and tenacity for forth coming generations. This interdisciplinary approach is essential for solving hazardous environmental issues and achieving sustainable development goals.

Email: padmavathipettela967@gmail.com

Preliminary Phytochemical and Pharmacological Investigations of

Ipomoea obscura

Dr. Pallavi. A, Harika .A,

Department of Biochemistry,

Sri Durga Malleswara Siddhartha Mahila Kalasala, Vijayawada-520010.

 

ABSTRACT

Ipomoea obscura, also known as morning glory or Vachagandha, is a creeping vine belonging to the family Convolvulaceae, widely distributed in various parts of the world. Screening of phytochemicals is a preliminary step in the detection of bioactive compounds present in particular medicinal plant and leads  to novel drug discovery .In the present study  Ipomoea obscura plant was identified in order to perform the phytochemical analysis by various standard methods and reported the presence of tannins, flavonoids, phenolics, saponins, steroids, cardiac glycosides and alkaloids and  quantitative  analysis  of tannins, saponins and flavonoids were investigated  .  The presence of these phytochemicals can be correlated with medicinal potential of the plant. Further pharmacological studies are carried out which are responsible for their activities and other medicinal values. The aim of the study deals with the phytochemical screening and pharmacological aspects of Ipomoea obscura, which includes phytochemical screening for different potent chemicals, antibacterial activity against human pathogenic strains [Salmonella sp. (MTCC); Staphylococcus aureus, Bacillus subtillis. Escherichia coli, Pseudomonas sp. etc]. The results provide justification for the use of the plant as a source of innovative plant based medicines to treat various infectious diseases.

 Keywords: Phytochemical screening, antibacterial activity, Ipomoea obscura.

       PLANT INSPIRED NANOSENSING TECHNOLOGY: A CUTTING EDGE ADVANCEMENT IN BIOMIMETICS 

 

Anshika Upadhyay¹,  S.L Keerthana²,  Dr M.Padma Sundari³

1year Student ,Department of botany,St Joseph’s College for Women(A),VSKP

2 year Student ,Department of botany,St Joseph’s College for Women(A),VSKP

3 Assistant Professor,  Department of botany,St Joseph’s College for Women(A),VSKP

 

ABSTARCT

Biomimicking has inspired several designers, architects and engineers. Mimicking nature’s elegant designs, produced after a thorough and elaborate process of natural selection is a familiar concept to human civilization. Plants dominate the earth and all of the biodiversity depends on them. Humans are no exception to it as we depend heavily on plants for our livelihood, food, industries and innovations. Nanotechnology, an emerging field of the 21st century, also draws inspiration from plants to develop new age nanosensors. Advanced research in nanosensing technology has a promising future in the fields of medicine, agriculture, Ecology , environmental science,robotics,photonics etc.  This article addresses the cutting edge nano-sensing technology inspired by plants. It also has the potential to lead us to a sustainable future.  Through this paper, the following areas will be explored. (1) Key concepts  of bioinspired nanosensing technology (2) Emerging plant-inspired nanosensing technologies in various fields (3) Concerns and ethical issues.

 

Keywords 

Biomimetics, Nanosensing, Engineering, Phyto Mimetics 

Evaluation of essential oil of Bursera penicillata for Chemical composition and in vitro antimicrobial or antioxidant activities

L. Prasanna Anjaneya Reddy¹,  L. Md. Bhakshu², L. Veeranjaneya Reddy³,  B.N. Reddy¹ and K. Venkata Ratnam^4*

¹Osmania University College for Women, Department of Botany, Osmania University, Hyderabad, Telangana, 500 001.

²Dr. YSR Government Degree College, Vedurukuppam, 517569; Chittoor District, A.P.

³Deparment of Microbiology, Yogi Vemana University, Kadapa, Andhra Pradesh 516 003,

⁴Department of Botany, Rayalaseema University, Kurnool, Andhra Pradesh – 518 007

*Corresponding author: drvenkatapkd@gmail.com

Abstract

Bursera penicillata (Sesse & Moc. ex  DC.) Engl. (syn. B. delpechiana Poss. ex Engl.) oil is extensively used as a fixative for high-grade perfumes, cosmetic products and in the manufacture of transparent soaps, is present in all parts of the plant, the highest yield can be obtained from husk of the berries. The present investigation was emphasized on chemical characterization and the antimicrobial or antioxidant activities of the essential oil of B. penicillata leaves and stem bark were not yet. 

The volatile oil was obtained from leaves or stem bark through steam distillation were yielded, 0.6% or 0.3% (v/w) respectively. The essential oil was characterized by gas chromatography coupled with flame ionization detector (GC-FID) and GC-MS attached with NIST-Mass 2006 data base. The retention indices were calculated by application of a modified Kovat’s procedure. The antioxidant activity was tested ammonium molybdate and DPPH reducing assay. The important components of the leaf oil were, terpenolene (34.1%), pinacrveol (16.84%), t-terpenene (9.97%)and citronellyl acetate (8.4%) and a-longipinene (5%) where the stem bark yielded cadiene (26.5%), b-phyllendrene (25.2%), carvone (15.8%), methylallyltrisulphide (6.6%), caryophellene (6.2%) and methylallyl sulphide (5.1%) as the major chemical components.  

The oils were exhibited a significant antimicrobial activity on the human pathogenic microorganisms such as, bacterial (Bacillus cereus, Staphylococcus aureus, Streptococcus feacalis, Escherichia coli, Proteus vulgaris, Pseudomonas aeruginosa) and fungal pathogens (Candida albicans and C. tropicalis) which effected at significantly lower concentrations. The oils were exhibited a good antioxidant activity is also point of discussion. The oils find applications in the medicine or development of cosmetics from the oil.  

KEY WORDS: Bursera penicillata; essential oil composition; antimicrobial activity, antioxidant activities.

 

 

 

 

 

 

 

 

 

AN OVERVIEW ON THE MICROPLASTICS AND ITS EFFECTS ON THE ENVIRONMENT AND HEALTH

L. Md. BHAKSHU^1*, V. PRABHAKAR RAO², P. VENKATESU³ AND

C. MEERA SAHEB⁴

^1-3, Dr. YSR Government Degree College, Vedurukuppam, Chittoor (Dt), 517569

⁴PVKN. Government College (A), Chittoor, 517002

*Corresponding author: lmbakshu@gmail.com

ABSTRACT

Microplastics are small plastic particles in the environment whose size fall in the range five mm to one micrometer. Recently microplastics were found in the ice of arctic region which shows that they can reach any corner of the world posing many dangers. Microplastics are becoming a potential risk factor to all the living organisms and slowly it is deteriorating the health,  living environment and biodiversity. Microplastics contain a number of toxic chemicals which pose severe risks to human health. The biggest health risk associated is with the chemical Bisphenol A (BPA), which is used to harden plastics. BPA causes alterations in liver functioning, insulin resistance, foetus development in pregnant women, the reproductive system, and brain functioning. Microplastics are produced through the fragmentation of larger plastic items like bottles, bags, and packaging material. They are also produced from microbeads used in personal care products like exfoliating scrubs, toothpaste, fibres released during the washing of synthetic textiles, weathering and degradation of plastic debris in the environment. Microplastics are secondary polluting agents originated from the plastics and easily enter in to the ecosystems and inside the bodies of living organisms causing a great menace to human kind. The present review focusses on the structural, functional aspects in addition to its ill effects. The possible solutions to guard from the microplastics are also being discussed in detail. The scientists and environmentalists have been focussing on the sustainable usage to avoid the microplastics and to make eco-friendly substances.

 

Key Words: Microplastics, effects on environment and health, sustainable materials

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

POSTER PRESENTAIONS

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

S.No	Name of the Participant	Designation	Stream Selected for Presentation	Name of the Institution	Place of the Institute
1	Bhavana	UG Student	Applied Sciences	B.v.k degree college	Dwarka nagar
2	Swetha Chinthala	Research Scholar	NanoSciences	GITAM (Deemed to be) University	Visakhapatnam
3	Sayantan Dalapati	UG Student	Clinical Sciences	BVK Degree College	Dwarka nagar
4	Yeshwitha.K & Deepika S	UG Student	Clinical Sciences	St. Joseph's College for Women	Visakhapatnam
8	B. Sophia charlie, Kundana, Rishitha	UG Student	NanoSciences	St. Joseph's College for Women	Visakhapatnam
10	Afreen sarveri	UG Student	rDNA Technology	St. Joseph's College for Women	Visakhapatnam
11	BuddhaRaju bharathi veda samhita	UG Student	Nanosciences	St. Joseph's College for Women	Visakhapatnam
12	Likhita konathala, Samhitha, Reshma	UG Student	NanoSciences	St. Joseph's. College for women (A)	Visakhapatnam
13	B. TANISHKA DEVI	UG Student	NanoSciences	St. Joseph's. College for women (A)	Visakhapatnam

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

DNA polymorphisms and Disease Identification

 Sayantan^1*, Bhavna², NSM Jyothi³

   1*-Student of BSc BTBCC, BVK Degree College, Visakhapatnam

2- Student of BSc CBZ, BVK Degree College, Visakhapatnam

3- (M.Phil)

  

Abstract 

Genetic differences among people within a community are referred to as DNA polymorphism.SNPs, insertions, deletions, and repeats are a few types.Procedure: Gathering samples, extracting DNA, amplifying it, genotyping it, and analysing the results.PCR, bioinformatics, and next-generation sequencing are important technologies.Applications include risk assessment, personalised medication, early diagnosis, and the identification of new diseases.Diseases that can be identified include Alzheimer's (APOE ε4), Type 2 Diabetes (TCF7L2), Breast Cancer (BRCA1/2), and Cystic Fibrosis (CFTR).Benefits include early detection, better prognosis, lower expenses, and precision treatment.Difficulties include high prices, complicated data, moral dilemmas, and restricted accessibility.Future directions: advancements in gene editing, increased genetic database size, and AI integration.Investments in research, a strong data infrastructure, and educational initiatives are necessary developments. Impact on healthcare: proactive health management and individualised care.Economic potential: Opportunities for global leadership and the biotech sector's growth.Protecting privacy and avoiding genetic prejudice are ethical issues.International cooperation: pooling resources and knowledge to tackle health issues.In conclusion, despite current obstacles, DNA polymorphism analysis has enormous potential to transform healthcare.

 Keywords

 Variations in DNA,SNPS Identification of Diseases,Sequencing of genes,Individual prescription drugs,Cancer treatment

  email id : dalapatisayantan169@gmail.com

 

Exploring the therapeutic potential of Andrographis paniculata derived Silver Nanoparticles in Cancer.

Swetha Chinthala¹, Siri Chandana Gampa², Sireesha V Garimella³.

Department of Life Sciences, School of Sciences

GITAM (Deemed to be University), Visakhapatnam. 

Andhra Pradesh- 530045

Abstract:

Medicinal plants and pharmaceuticals made from plants, have long been used to treat a wide range of illnesses. Approximately 80,000 plant species have been discovered and harnessed for their medicinal properties across the globe. India has the most extensive, oldest, diverse, and adaptable cultural legacy when it comes to the utilization of medicinal herbal plants. 

Andrographis paniculata, a widely recognized medicinal plant, has garnered attention for its therapeutic properties. The plant's flavor is entirely bitter, earning it the moniker "King of Bitter" from its intense bitterness. This study investigates the synthesis of silver nanoparticles (AgNPs) using Andrographis paniculata leaf extract and evaluates their antimicrobial and cytotoxic activities. The synthesis of AgNPs was confirmed by UV-Vis spectroscopy, revealing characteristic absorption peaks indicative of nanoparticle formation. The antimicrobial efficacy of AgNPs was assessed against a panel of pathogenic microorganisms, demonstrating significant inhibition, particularly against Gram-positive bacteria. Furthermore, cytotoxicity assays using mammalian cell lines indicated dose-dependent toxicity of AgNPs, highlighting their potential biomedical applications. This research underscores the dual functionality of Andrographis paniculata-derived AgNPs as promising antimicrobial agents and cytotoxic agents warranting further investigation for therapeutic development. Overall, this study highlights the promising bioactive properties of AgNPs synthesized from Andrographis paniculata, contributing to the growing body of research on nanotechnology-based approaches to combat microbial infections and explore cytotoxic effects in medical applications.

 Email- swethachinthala21@gmail.com

 

 

 Organ Printing: A Revolutionary Approach to Tissue Engineering and Regenerative Medicine

K. Yeshwitha ^1*,  S. Deepika^2*, Dr.P.Mary anupama ^3*

1,2,Students of 3^rdBsc (BBC), St. joseph’s college for women(A),

3. Head of  the Dept. of Biochemistry, St. joseph’s college for women (A), Vsp

 

ABSTRACT

Organ printing is a cutting-edge biotechnology that enables the fabrication of functional three-dimensional (3D) organs and tissues using living cells and biomaterials. This innovative approach combines advances in stem cell biology, biomaterials science, and 3D printing technology to create organs and tissues that can replace or repair damaged ones. The organ printing process involves the selection and expansion of relevant cell types, the design and fabrication of biomaterial scaffolds, and the precise deposition of cells and biomaterials into a 3D structure using a printing device. The resulting constructs are then matured and conditioned to promote tissue formation and functionality. Organ printing has the potential to address the shortage of organs available for transplantation, enable personalized medicine, and revolutionize the field of tissue engineering and regenerative medicine. With its ability to create complex tissue architectures and functional organs, organ printing holds immense promise for transforming the treatment of a wide range of diseases and injuries, and improving human health outcomes.

Key words : Organ printing, Tissue engineering, Regenerative medicine, 3D printing, Biomaterials, Stem cell biology, Scaffold fabrication, Personalized medicine.

 

*Author of correspondence-

Miss K. YESHWITHA

Miss S. DEPIKA

Students of 3^rd BSc BBC

Mail ID : kyeshwitha@gmail.com

              : Deepikahhsingampalli@gmail.com

 

GREEN NANOTECHNOLOGY

Student of the St. Joseph’s College For Women (A)

 

S. Kundana and B. Sophia

 

 

ABSTRACT

Green nanotechnology focuses on the development and application of nanomaterials with an emphasis on environmental sustainability and reducing ecological impacts. Key areas include eco-friendly nanomaterial synthesis, environmental remediation, and energy efficiency. This approach integrates principles of green chemistry and green engineering to create safer, renewable, and recyclable materials. Applications range from improved water treatment and pollution control to advanced energy storage solutions. Green nanotechnology aims to balance technological advancement with environmental stewardship, addressing global challenges like climate change and resource depletion while promoting sustainable development.

 

Keywords:

Green nanotechnology, sustainability, eco-friendly, nanomaterials, green chemistry, environmental remediation, energy efficiency, renewable resources, pollution control, sustainable development.

 

Author for correspondence

Name: S. Kundana and B. Sophia Affiliation: 2nd  B Sc. Biotechnology

St. Joseph’s College For Women (A) Visakhapatnam

Phone no: 6301162662 ; 93460 04061

Email id: kundanasanapathi@gmail.com

 

NANO TOXICOLOGY

ABSTRACT

By Students of St. Joseph’s college for women

Nanotoxicology is an emerging field that addresses the potential health and Environmental risks associated with nanomaterials. nanotoxicology Investigates the bioaccumulation and persistence of nanomaterials in the Environment, their potential to disrupt ecological systems. By integrating toxicological assessments with nanomaterial design and regulatory Frameworks, nanotoxicology strives to ensure the safe  and sustainable Development of nanotechnology, minimizing risks while maximizing benefits To society.

B.B.V. Samhitha, K.Likitha, A.Reshma

2nd BSC BIOTECHNOLOGY

Visakhapatnam

9346706569

samhithabharathivedha@gmail.com

 

 

 

 

NANO BIOSENSORS

ABSTRACT

Student of St. Joseph college for women

 In recent years, there has been immense advancement in the development of nanobiosensors as these are a fundamental need of the hour that act as a potential candidate integrated with point-of-care-testing for several applications, such as healthcare, the environment, energy harvesting, electronics, and the food industry. Nanomaterials have an important part in efficiently sensing bioreceptors such as cells, enzymes, and antibodies to develop biosensors with high selectivity, peculiarity, and sensibility. The combination of nanostructured materials and biosensors is generally known as nanobiosensor technology. These miniaturized nanobiosensors are revolutionizing the healthcare domain for sensing, monitoring, and diagnosing pathogens, viruses, and bacteria.

Author for correspondence

B. TANISHKA DEVI

(6392690130)

V. TEZASWWIEE

(9247966535)

P. YERNI LAXMI BHAVANI

(9347106812)

2^nd YEAR Bsc BIOTECHNOLOGY

ST.JOSEPH COLLEGE FOR WOMEN ,VISAKHAPATNAM

EMAIL ID:

tanishkaboddeti06@gmail.com

veduritezaswwiee@gmail.com

hariniappu73@gmail.com

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Clinical Sciences

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

S.No	Name of the Participant	Designation	Name of the Institution	Place of the Institute
1	S.M.V Harsha Vardhan	UG Student	Srinivasarao College of Pharmacy	Pm Palem Visakhapatnam
2	N. Naga Varshitha	UG Student	Srinivasarao college of pharmacy	PM. Palem, Vizag
3	Dr Sailaja Polavarapu	Others	Gayatri Vidya Parishad Institute of Health Care and Medical Technology	Marikavalasa, Visakhapatnam
4	Dr. R. Poorani	Others	Gayatri Vidya Parishad Institute of Health Care and Medical Technology	Visakhapatnam
5	SINGAMPALLI HARSHA SADGUN & BUSI ANGELINE BHASKAR	Research Scholar	DEPARTMENT OF PSYCHOLOGY	ANDHRA UNIVERSITY
6	D.SATYASIVAGANESH	Assistant Professor	M.R.COLLEGE(AUTONOMOUS)	VIZIANAGAARM
7	Modi Pavani	UG Student	St. Joseph's College for Women	Visakhapatnam
8	G. Likitha	UG Student	St. Joseph's College for Women	Visakhapatnam
9	G. Indhu	UG Student	St. Joseph's College for Women	Visakhapatnam
10	visakha singh	UG Student	St. Joseph's College for Women	Visakhapatnam
11	Reena.P & Sai Sri	UG Student	St. Joseph's College for Women	Visakhapatnam
12	D.SATYASIVAGANESH	Assistant Professor	M.R.COLLEGE(AUTONOMOUS)	VIZIANAGAARM
13	KONDA V V S KRISHNA	Assistant Professor	Government Polytechnic for Women, Srikakulam	Srikakulam
14.	B. Lakshmi Prasanna Latha, and P. Venkatesu	Assistant Professor	Dr YSR GDC,	Vedurukuppam

 

 

 

 

 

 

 

 

 

 

Determining the potential of a combination therapy in hypertensive patients with cardiac comorbidities.

S.M.V Harsha Vardhan and Naga Varshitha

UG Student, Srinivasarao College of Pharmacy, Visakhapatnam

 

ABSTRACT

Blood pressure refers to the force against the walls of the body’s arteries, and major blood vessels which is exerted by the circulating blood. The main aspect of our study is to focus on hypertensive patients with comorbid conditions related to cardiac issues. In this study the effectiveness and safety of three different treatment approaches were compared and studied which include Amlodipine (alone) - Medication A, Telmisartan (alone) – Medication T, Combination of both Amlodipine and Telmisartan– Medication (A+T). The study involves patients attending cardiology clinics and checking their health progress over a particular period.  The primary goal is to know about the therapeutic efficacy in reducing the blood pressure by the medication and also examining potential side effects. The Investigations of the study found that the treatment with the Combination of Amlodipine(A) + Telmisartan(T) were much more effective in patients with poorly controlled hypertension associated with cardiac abnormalities. This study evaluates the efficacy and safety of combining amlodipine and telmisartan in managing hypertension in 75 patients admitted to cardiac wards. These results support the clinical usage of amlodipine and telmisartan as a valuable treatment option for the patients with Hypertension and associated heart conditions, this treatment highlights the comprehensive management approaches which helps in improving patient outcomes and improving their overall cardiovascular health.

KEYWORDS

Hypertension, comorbid conditions, cardiac issues, amlodipine, telmisartan, therapeutic efficacy, side effects, combination

 

Role of AA and its metabolite in the protection of pancreatic β- cells and improve hyperglycemia induced by bleomycin

 

Sailaja Polavarapu¹ Poorani Rhenghachar¹, Undurti N Das^2-3

¹Department of Microbiology, Gayatri Vidya Parishad Institute of Health Care and Medical Technology, Visakhapatnam, India;

²UND Life Sciences, 2221 NW 5th St, Battle Ground, WA 98604, USA:

³Department of Biotechnology, Indian Institute of Technology-Hyderabad, Sangareddy,

Telangana, India;

 

ABSTRACT

Bleomycin (BLM), a widely used antineoplastic drug, induces pulmonary fibrosis. In addition, it is also known that bleomycin can cause pancreatic injury. In the current study, we noted that bleomycin induced apoptosis of Rat Insulinoma (RIN5F) cells can be prevented by arachidonic acid (AA, 10μg/ml) and lipoxin A4 (LX A4, 1ng/ml, an anti-inflammatory metabolite of AA. An increase in LXA4 levels was noted when RIN5F cells were supplemented with AA. Bleomycin induced significant increase in the fasting blood glucose levels and decreased plasma insulin levels could be reversed by LXA4. AA and LXA4 improved the antioxidant status and upregulated anti-inflammatory and anti-apoptotic genes such as IκB and Bcl2. These results suggest that AA and LXA4 can be employed to prevent bleomycin-induced dysfunction of pancreatic β cell function.

 

Protectin DX- an inflammation resolution metabolite of docosahexaenoic acid, protects against the development of streptozotocin-induced type 1 and type 2 diabetes mellitus in male Swiss albino mice

Poorani Rhenghachar¹, Sailaja Polavarapu¹, and Undurti N. Das^2,3

¹Department of Microbiology, Gayatri Vidya Parishad Institute of Healthcare and Medical Technology, Visakhapatnam, India,

²R&D, UND Life Sciences, Battle Ground, WA, United States, 

³Department of Biotechnology, Indian Institute of Technology-Hyderabad, Sangareddy, Telangana, India

ABSTARCT

Diabetes mellitus (DM) is common across the globe. Of the two major types of DM, type 1 and type 2, the latter is more common. Both type 1 and type 2 DM are associated with inappropriate inflammation, immune dysfunction and gut dysbiosis. In our efforts to identify other similar lipid based anti-diabetic molecules, we investigated potential anti-diabetic action of protectin DX that also has anti-inflammatory and inducer of inflammation resolution action(s) like LXA4. Protectin DX{10(S)                                            ,17(S)-dihydroxy-4Z, 7Z,11E,13Z,15E,19Z-docosahexaenoic acid, also called as 10(S),17(S) DiHDoHE)} prevented the development of streptozotocin induced type 1 and type 2 diabetes mellitus in Swiss male albino mice. Protectin DX showed potent anti-inflammatory, antioxidant and anti-apoptotic actions that could explain its anti-diabetic action. The results of the present study showed that protectin DX can prevent development of both type 1 and type 2 DM in addition to restoring plasma insulin levels, food and water intake and bodyweight, plasma levels of IL-6, IL-10, TNF-a; expression of Bcl-2/Bax, iNOS, NF-kB and IkB genes, balance between pro- and anti-oxidants; OGTT and insulin indices to near normal. In view of these beneficial actions, efforts need to be developed to exploit PDX and other similar compounds as potential anti-diabetic molecule in humans.

Key Words: Diabetes mellitus, Protectin Dx, antioxidant, anti-inflammatory, anti-diabetic.

Presenter: Dr. R. Poorani

 

 

 

 

 

 

 

Understanding Proactive Aggression and Its Association with Internet Gaming Disorder in Adolescents

 

S Harsha Sadgun*, B Angeline Bhaskar¹

*Research scholar, Department of psychology, Andhra university

¹MSc psychology, Department of psychology, Andhra university

 

ABSTRACT

Internet Gaming Disorder (IGD) has become a prevalent concern among adolescents worldwide, including in India, where approximately 19.4% of adolescents exhibit problematic gaming behaviors. This study investigates the relationship between IGD and proactive aggression among 845 adolescents in Visakhapatnam, aged 14-21 years, using the Internet Gaming Disorder Scale - Short Form (IGDS9-SF) and the Reactive-Proactive Aggression Questionnaire (RPQ). Demographic variables including age, gender, and education levels were examined for their influence on IGD and aggression. Results indicated that late adolescents and males showed higher levels of both IGD and proactive aggression, while middle adolescents exhibited heightened proactive aggression. Rural and postgraduate students also demonstrated increased aggression, emphasizing the impact of socio-environmental factors on behavioral outcomes. The study highlights the need for targeted interventions to address gaming addiction and aggressive behaviors among adolescents in diverse socio-cultural contexts.

Keywords: Adolescents, Aggression, Gaming Addiction, Youth Behavior, Mental Health

EMAIL: harshasadgun5.sh@gmail.com

EMAIL: joypalukurty@gmail.com

RECENT ADVANCES IN CLINICAL SCIENCES: INNOVATIONS IN DRUG DELIVERY SYSTEMS

Konda V V S Krishna, 

Lecturer in Pharmacy, Government Polytechnic for Women, Srikakulam

 

ABSTRACT 

This review article explores recent advances in clinical sciences with a focus on innovations in drug delivery systems. The study aims to provide a comprehensive overview of novel drug delivery methods including nanoparticles, liposomes, and transdermal patches. Key areas covered include the mechanisms of drug delivery, targeting strategies, and clinical applications in treating various diseases. The review also discusses recent advancements, challenges, and prospects in the field of drug delivery systems. This synthesis of current knowledge aims to inform and guide future research and application in pharmaceutical sciences.

Keywords: Clinical Sciences, Drug Delivery, Nanoparticles, Liposomes, Transdermal Patches

Email: kondavvskrishna@gmail.com

"Health Impacts and Long-Term Consequences of COVID-19: A Comprehensive Review"

Sri. D.Satya Siva Ganesh¹,Sri. Anapana Gopal² , Kum. K.Radha³ ,Sri. S. Nagaraju ⁴

1  Assistant Professor in Zoology , Maharajah’s College (Autonomous), Vizianagaram 

    2   Assistant Professor in Zoology , Maharajah’s College (Autonomous), Vizianagaram

3   Assistant Professor in Zoology , Maharajah’s College (Autonomous), Vizianagaram   

4   Assistant Professor in Zoology , Maharajah’s College (Autonomous), Vizianagaram       

                                       

 Mail Id:mscmscmedsiva@gmail.com

 

RENAL FUNCTION TESTS ASSOCIATED WITH KIDNEY DISEASES

G.Likitha ^1* , Dr. P. Mary Anupama²

1. student of 3^rd B Sc (BBC) , St. Joseph ‘s college For women

2. Head and Asst Prof , Dept . of Biochemistry , St. Joseph’s College For women (A) , Vsp.

 

ABSTRACT

Renal function tests are essential diagnostic tools used to assess the efficiency and health of the kidneys. These tests provide valuable information about how well the kidneys are filtering waste from the blood, maintaining electrolyte balance, and producing hormones crucial for various bodily functions. They are critical in diagnosing and monitoring a wide range of kidney disorders, from acute kidney injury to chronic kidney disease.    One of the primary tests used to evaluate kidney function is serum creatinine measurement. Creatinine is a waste product generated from muscle metabolism and is excreted by the kidneys. Elevated levels of serum creatinine indicate impaired kidney function because the kidneys are unable to effectively filter and excrete creatinine from the blood. Creatinine clearance tests, which involve collecting urine samples over a specified period, provide a more accurate assessment of kidney function by calculating the rate at which the kidneys clear creatinine from the blood.

Electrolyte levels (e.g., potassium, sodium, bicarbonate) are crucial indicators of kidney function, as the kidneys maintain electrolyte balance. Abnormalities can indicate kidney dysfunction. Urinalysis evaluates urine composition, detecting proteinuria (excess protein in urine), blood cells, or casts (structures formed in kidney tubules). These abnormalities may signify kidney damage or disease. Renal function tests are vital for diagnosing kidney disorders, monitoring disease progression, and guiding treatment. Early detection and intervention can prevent complications and improve outcomes in kidney disease management.

 

  Key words :- Serum creatinine, Urinalysis , Electrolyte balance. 

     

 *Author for correspondence-

Miss Likhita

Student of ^3rd BBC

Mail ID – garikinalikhita1403@gmail.com

Bacteria Associated with Urine: Diversity, Clinical Relevance, and Future Directions

G.Indhu^1*, Dr. P. Mary Anupama^2*

1. Student of 3^rd B.Sc. (BBC), St. Joseph’s college for women
2. Head and Asst. Prof., Dept. of Biochemistry, St. Joseph’s College for Women (A), Vsp

 

ABSTRACT

Urine, traditionally considered sterile, harbours a diverse microbiota influenced by age, gender, and health status. Recent advances in sequencing technologies have unveiled a complex ecosystem of bacteria in urine samples, challenging previous notions of sterility. These bacteria, including both commensals and potential pathogens, play pivotal roles in urinary tract infections (UTIs) and broader urological health. 

The primary bacteria found in urine samples from UTI patients include Escherichia coli (E. coli), Klebsiella pneumoniae, Enterococcus spp., and Proteus mirabilis. E. coli is the most prevalent, responsible for approximately 80-85% of community-acquired UTIs. It possesses virulence factors such as fimbriae and toxins that aid in adhesion and invasion of urinary tract epithelial cells. K. pneumoniae and Enterococcus spp. are also frequently isolated, contributing to nosocomial UTIs due to their ability to form biofilms and resist host defences and antibiotics. Antibiotic resistance is a growing concern in UTIs, with E. coli exhibiting resistance to commonly prescribed antibiotics like fluoroquinolones and trimethoprim-sulfamethoxazole. Extended-spectrum beta-lactamase (ESBL)-producing strains of E. coli and K. pneumoniae further complicate treatment options, necessitating the use of carbapenems, often considered last-line antibiotics. Enterococcus spp. are notorious for intrinsic resistance to many antibiotics, including aminoglycosides and cephalosporins, posing challenges in therapeutic management. The pathogenesis of UTIs involves bacterial ascent from the periurethral area to the bladder, facilitated by factors such as sexual activity, improper hygiene, and urinary tract abnormalities. Upon colonization of the bladder, bacteria adhere to urothelial cells and initiate inflammation, leading to the classical symptoms of UTIs like dysuria, frequency, and urgency. In severe cases, bacteria can ascend to the kidneys, causing pyelonephritis, which requires prompt medical intervention to prevent complications such as sepsis and renal damage. Diagnostic methods for UTIs include urine culture and susceptibility testing, which guide antibiotic therapy based on identified pathogens and their resistance profiles. Rapid diagnostic tests like urinary dipsticks are commonly used in clinical settings for initial screening, although culture remains the gold standard.n conclusion, understanding the bacterial species associated with UTIs is crucial for effective diagnosis and treatment. E. coli predominates as the leading causative agent, while other bacteria like K. pneumoniae and Enterococcus spp. contribute significantly, particularly in healthcare-associated infections. Antibiotic resistance poses a substantial challenge, emphasizing the need for judicious antibiotic use and development of alternative treatment strategies. Future research should focus on novel therapeutic approaches and vaccines targeting UTI pathogens to mitigate the global burden of urinary tract infections.

Keywords urine microbiota, bacterial diversity, urinary tract infections (UTIs), molecular diagnostics.

*Author for Correspondence- 

Miss G. Indhu

Student of 3^rd BBC

Contact Number- 

Mail ID: indhugiduthuri15@gmail.com

                             

Liver function test associated with liver disease

                                 Vishakha singh¹*, Dr. M.Padma Sundari²

        1.  Student of 3^rd B.Sc (BBC), St. Joseph’s college for women

2.Head and Asst. Prof., Dept. Of Botony ,St. Joseph’s College for Women (A), Vsp

 

  ABSTRACT

Liver function tests (LFTs) are a group of blood tests that provide valuable information about the state of a patient’s liver. These tests measure various enzymes, proteins, and substances produced or processed by the liver. Commonly assessed parameters in LFTs include alanine aminotransferase (ALT), aspartate aminotransferase (AST), alkaline phosphatase (ALP), bilirubin, and albumin. Each parameter offers insights into different aspects of liver health and functionality.ALT and AST are enzymes that help metabolize amino acids. Elevated levels of these enzymes in the blood often indicate liver damage or inflammation, as these enzymes are released from damaged liver cells. While ALT is more specific to the liver, AST is also found in other tissues, such as the heart and muscles, which can sometimes complicate the interpretation of AST results.ALP is an enzyme related to the bile ducts, and high levels can indicate blockages or other issues in the bile ducts, such as cholestasis. It can also be elevated in bone diseases, so it is important to interpret ALP levels in conjunction with other liver tests and clinical information.Bilirubin is a byproduct of the normal breakdown of red blood cells. The liver processes bilirubin, making it easier for the body to excrete. Elevated bilirubin levels can lead to jaundice, characterized by yellowing of the skin and eyes, and may indicate liver dysfunction or hemolysis.Albumin is the main protein made by the liver and plays a critical role in maintaining oncotic pressure and transporting hormones, vitamins, and drugs throughout the body. Low levels of albumin can indicate chronic liver disease, such as cirrhosis, or other conditions like malnutrition and nephrotic syndrome.

While LFTs provide important information, they are not definitive on their own. Abnormal results may necessitate further diagnostic procedures, such as imaging studies (ultrasound, CT scan, MRI) or liver biopsy, to obtain a more comprehensive understanding of the liver’s condition. 

Key word : Bilirubin, Amino transferase, aspartate amino transferase , alkaline phosphatase

 

*Author for correspondence –

Miss Vishakha 

Student of 3^rd BBC

Mail Id- vishakha27092002@gmail.com

 THE EFFECT OF MALNUTRITION ON HUMAN HEALTH AT VARIOUS STAGES OF LIFE

B. Lakshmi Prasanna Latha^1*, and P. Venkatesu²

¹Department of Zoology, Dr YSR GDC, Vedurukuppam, Chittoor District, A.P-517569

²Department of Physics, Dr YSR GDC, Vedurukuppam, Chittoor District, A.P-517569

^*Corresponding Author Email: lakshmi73zoology@gmail.com

 

ABSTRACT

In recent times, Malnutrition - a widespread worldwide problem, affects people of all ages by encompassing both under- and overnutrition. Stunting, wasting, and a lack of certain nutrients are signs of undernutrition, which can lead to diseases like weaker immune systems, decreased growth, and cognitive impairments. On the other hand, overnutrition, which results from an excess of calories consumed and a nutritional imbalance, causes obesity and the health concerns that go along with it, including diabetes and cardiovascular illnesses.

Malnutrition has many different causes, such as inadequate food consumption, poor dietary choices, sociocultural influences, chronic illnesses, and economic inequality. Key nutritional deficiencies, such as those in vitamins A, D, and minerals like iron and zinc, are common and have been related to a range of health problems, including osteoporosis, cardiovascular disease, and cognitive decline. Targeted interventions are needed to address these deficiencies, such as the use of fortified foods and educational initiatives to increase access to balanced diets and improve nutritional awareness.

Aware of the urgency, the World Health Organization (WHO) has taken steps to improve public health outcomes by promoting nutritionally enhanced foods and fortification programs, with a focus on women of reproductive age and vulnerable populations. The significance of comprehensive health interventions, food security, and adequate nutrition is emphasized by prevention measures.

In this paper the authors try to explore the types of nutrition, the role of various nutrients, the causes of malnutrition across different age groups, its symptoms, and effective prevention strategies.

 

Keywords: Malnutrition, Nutritional deficiencies, Under-nutrition, Overnutrition

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Food Sciences and Applied Sciences

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

S.No	Name of the Participant	Designation	Name of the Institution	Place of the Institute
1	Dr. M. Hanumantha Raju	Assistant Professor	KRK Government Degree College	Addanki. Bapatla Dt
2	Dr.G.Nagamani & Dr.T.K.Padmaja	Assistant Professor	Sri padmavathi women's degree and pg college Tirupathi	Tirupati
3	Dr. P Aruna, Dr. P Vinod Kumar	Assistant Professor	Yogi Vemana University	Department of Food Technology, Vemana Puram, Kadapa-516003
4	Nigama samhitha , Jahnavi and V. Devaki nandini	PG Student	Yogi vemana university	Kadapa Andhra Pradesh
5	NAGARAJU.SURARAPU	Assistant Professor	MAHARAJA'S AUTONOMOUS COLLEGE	Vizianagaram, Andhra Pradesh
6	Dr. Y. Shanti Prabha	Assistant Professor	Dr. V S Krishna Government Degree College  ( Autonomous) Visakhapatnam	Visakhapatnam
7	Likhitha Yadav. Prakruthi	Research Scholar	Gitam (Deemed to be University)	Visakhapatnam
8	B LIKITA SRI & Dr T. Gayatri	PG Student	St. JOSEPH COLLEGE FOR WOMEN (A)	GNANAPURAM, VISHAKAPATNAM
9	P.Hani	UG Student	St Joseph's College for women	Visakhapatnam
10	Harshitha Chinni	UG Student	St.Joseph college for women (A)	Gnanapuram, convent junction
11	B.Dishitha	UG Student	St Joseph's College for women	Visakhapatnam
12	B Lakshmi Prasanna Latha	Assistant Professor	DrYSRGDC	Vedurukuppam
13	Vadarevu Sony	Assistant Professor	St Joseph's College for women	Visakhapatnam
14.	V. Prabhakar Rao1, P. Jeevan Jyothi, L. Md. Bhakshu, B. L. Prasanna Latha, T. Gunasekhar	Lecturer	Dr. YSR Government Degree College	Vedurukuppam
15.

 

 

 

 

 

THE ROLE OF RECENT ADVANCES IN BIOLOGICAL SCIENCES FOR THE BENEFIT OF THE MANKIND

Dr. M. Hanumantha Raju

Asst. Professor in Zoology, KRK Govt. Degree College, Addanki.Bapatla District.

 

                                                ABSTRACT

Biological science is a vast and rapidly advancing field that encompasses every from the study of microorganisms to the working of the human body. In recent years, researches have made significant work in understanding the complex process that govern life, from the genetic code to the behaviour of ecosystems.  Some areas like Genetics  and Genomics Microbiology molecular Biology, Neuroscience, Biotechnology, Bioinformatics, and Ecology & conservation have been rapidly advances and their studies are being benefited to the mankind in various aspects.  The great Biological discoveries revolutionized life sciences are Inherence/Evolution   (1800s) Antibiotics (1928), Gel Electrophoresis (1931), Cell discovery (1951), the structure of DNA (1952), DNA polymerases and restriction enzymes  to recombinant DNA technology and finally to biomedical research and health care. Developing drugs and Vaccines to prevent the viral infections are also the recent miracles in the biological field and research.  Anyhow  more work has to be done to strengthen the future biological researched and dedication for the coming generations.

Keywords:

Biosocial studies – previous and recent – discoveries  - benefit for society.

Contact number :Mobile: 94411 30264.

RECENT ADVANCES IN FOOD SCIENCE AND TECHNOLOGY

Dr. G. Nagamani *, T.K. Padmaja**, S. Varalakshmi**

*Lecturer, Department of Home Science, Sri Padmavathi Women’s Degree and PG College Tirupati.

**Lecturer, Department of Biochemistry, Sri Padmavathi Women’s Degree and PG College Tirupati.,

 

ABSTRACT

The study aims to present global challenges such as food security, sustainability, health and quality.  It explores several key areas where significant progress has been made highlighting cutting edge technologies and their implications for future of food science.  Advances in food processing have enhanced, texture and nutritional profile of these products, making them more appealing to consumers.  Ensuring food safety and extending shelf life are perennial challenges in food science. Recent advances include the development of smart packaging technologies that monitor food freshness and quality. These packages can detect spoilage and provide real-time information to consumers and retailers, reducing food waste. Innovations in food preservation techniques, such as high-pressure processing (HPP) and pulsed electric fields (PEF), have also improved the safety and shelf life of perishable foods without compromising their nutritional value and sensory properties.

            The focus on health and wellness has driven the development of functional foods and nutraceuticals that offer specific health benefits beyond basic nutrition. Advances in food fortification and enrichment have led to the creation of products that address nutritional deficiencies and support overall health. Probiotics, prebiotics, and bioactive compounds are increasingly being incorporated into foods to promote gut health, boost the immune system, and prevent chronic diseases. Personalized nutrition, driven by advances in genomics and metabolomics, is another emerging field that tailors dietary recommendations to individual genetic profiles and metabolic needs.  Automation and robotics are revolutionizing food processing and manufacturing. Automated systems and robotic technologies improve efficiency, consistency, and safety in food production.  Advanced food processing techniques, such as 3D food printing, are also gaining momentum, offering new possibilities for customized food designs and formulations. Reducing the environmental impact of food production and consumption is a major focus of recent research. The concept of a circular economy, where waste is minimized, and by-products are reused, is being increasingly applied in the food industry. Innovations such as converting food waste into bio plastics, biofuels, and animal feed are gaining attention. Moreover, sustainable packaging solutions, including edible and biodegradable packaging, are being developed to address the plastic waste crisis. 

In conclusion, the recent advances in food science are shaping a more sustainable, healthy, and efficient food system. By leveraging cutting-edge technologies and innovative practices, the field is poised to address some of the most pressing global challenges, ensuring a secure and nutritious food supply for future generations.

Email: ngattupalli@gmail.com

 

RECENT ADVANCES IN FOOD SCIENCE AND TECHNOLOGY

 

Dr. G. Nagamani *, T.K. Padmaja**, S. Varalakshmi**

*Lecturer, Department of Home Science, Sri Padmavathi Women’s Degree and PG College Tirupati.

**Lecturer, Department of Biochemistry, Sri Padmavathi Women’s Degree and PG College Tirupati.,

 

ABSTRACT

The study aims to present global challenges such as food security, sustainability, health and quality.  It explores several key areas where significant progress has been made highlighting cutting edge technologies and their implications for future of food science.  Advances in food processing have enhanced, texture and nutritional profile of these products, making them more appealing to consumers.  Ensuring food safety and extending shelf life are perennial challenges in food science. Recent advances include the development of smart packaging technologies that monitor food freshness and quality. These packages can detect spoilage and provide real-time information to consumers and retailers, reducing food waste. Innovations in food preservation techniques, such as high-pressure processing (HPP) and pulsed electric fields (PEF), have also improved the safety and shelf life of perishable foods without compromising their nutritional value and sensory properties.

            The focus on health and wellness has driven the development of functional foods and nutraceuticals that offer specific health benefits beyond basic nutrition. Advances in food fortification and enrichment have led to the creation of products that address nutritional deficiencies and support overall health. Probiotics, prebiotics, and bioactive compounds are increasingly being incorporated into foods to promote gut health, boost the immune system, and prevent chronic diseases. Personalized nutrition, driven by advances in genomics and metabolomics, is another emerging field that tailors dietary recommendations to individual genetic profiles and metabolic needs.  Automation and robotics are revolutionizing food processing and manufacturing. Automated systems and robotic technologies improve efficiency, consistency, and safety in food production.  Advanced food processing techniques, such as 3D food printing, are also gaining momentum, offering new possibilities for customized food designs and formulations. Reducing the environmental impact of food production and consumption is a major focus of recent research. The concept of a circular economy, where waste is minimized, and by-products are reused, is being increasingly applied in the food industry. Innovations such as converting food waste into bio plastics, biofuels, and animal feed are gaining attention. Moreover, sustainable packaging solutions, including edible and biodegradable packaging, are being developed to address the plastic waste crisis. 

In conclusion, the recent advances in food science are shaping a more sustainable, healthy, and efficient food system. By leveraging cutting-edge technologies and innovative practices, the field is poised to address some of the most pressing global challenges, ensuring a secure and nutritious food supply for future generations.

Email: ngattupalli@gmail.com

 

Drying kinetics of bitter gourd rings and their nutrient composition and physical sensory attributes.

P. Vinod Kumar P. Aruna^*,

Yogi Vemana University College, Vemana Puram Kadapa-516003

Corresponding author*Email:pamisettyaruna@gmail.com

 

Abstract

An attempt was made to reduce the moisture content by using different dryers in bitter gourd rings, which contains a unique phyto-constituents. The drying rate was same for the samples dried in thin layer dryer at 40°C and in solar tunnel drier. Among the drying methods, the thin layer drying has high drying rate with less moisture content compared to solar tunnel drier and sun drier. The drying of samples in thin layer drying at 60°C has taken less time when compared to other type of driers. The time taken to dry in solar tunnel drier and sun drying is same but in tunnel drier there is color retention where as in sun drying the bitter gourd rings appears pale white in color. Sensory attributes were scored higher in solar drier when compared to other dried samples. The flavour was good in all types of drying but in sun dried its sour buttermilk. Green color retention was observed only in the sample dried in solar tunnel drier. In addition to that, loss of quinine was more in the sun dried sample which results in the loss of bitterness. The quinine content of sun dried sample is 470.25mg. The 19.12mg calcium content was found at 40°C in thin layer drier and solar tunnel drier and vitamin - C of 79.12mg. The samples dried in thin layer drying at 40°C is the best method to dry bitter gourd rings because it took less drying time and scored high in sensory attributes of texture, appearance, colour and flavor, but solar tunnel drying is the greenhouse method to dry bitter gourd rings because it doesn’t require input energy as it directly acquires from the sunlight.

 

 

PREPARATION AND STANDARDIZATION OF MORINGA CANDY 

V DEVAKI NANDINI, P NIGAMA SAMHITHA , P JAHNAVI 

Yogi Vemana University, Kadapa

 

ABSTRACT

Moringa candy represents a novel confectionery product that leverages the nutritional benefits of Moringa oleifera, a plant known for its high content of vitamins, minerals, and antioxidants. V DEVAKI NANDINI, P NIGAMA SAMHITHA , P JAHNAVI developed this product under the mentorship of Dr. V RAMA KRISHNA and Dr. P ARUNA . This  explores the potential of moringa candy as a functional food, its health benefits, production process, and market potential.

Moringa oleifera, commonly known as the drumstick tree, is renowned for its nutrient-dense leaves, which contain significant levels of vitamin C, vitamin A, calcium, potassium, and protein. Incorporating moringa into candy can offer a convenient and palatable way to deliver these nutrients to a broad audience, including children and adults who may be reluctant to consume leafy greens.Moringa candy can provide various health benefits due to its rich nutritional profile. Regular consumption may help improve immune function, support bone health, enhance skin health, and provide antioxidant protection. Moreover, moringa’s anti-inflammatory properties can contribute to overall well-being.The production of moringa candy involves several steps, including the harvesting and drying of moringa leaves, powdering the dried leaves, and incorporating the powder into a candy base. The formulation must ensure that the nutritional integrity of moringa is maintained while achieving an acceptable taste and texture. Natural sweeteners and flavor enhancers can be used to improve palatability.

The market for health-oriented confectionery products is growing, driven by increasing consumer awareness of nutrition and wellness. Moringa candy can appeal to health-conscious consumers seeking convenient, nutrient-rich snacks. Effective marketing strategies highlighting the health benefits and natural ingredients can enhance product acceptance and market penetration.Moringa candy offers a promising opportunity to combine health benefits with consumer-friendly confectionery. By harnessing the nutritional power of moringa, this product can cater to the demand for functional foods and support better health outcomes. Further research and development are needed to optimize the formulation and production processes to ensure product quality and consumer satisfaction.

Author for correspondence- pasalurijahnavi@gmail.com

 

Protein Extracts from Stomopneustus variolaris with antidiabetic potential - a mini review

Dr. Y. Shanti Prabha, 

Lecturer in Zoology, Dr. V S Krishna Government Degree College (Autonomous), VSKP

 

ABSTRACT

Stomopneustus variolaris, commonly known as the purple sea urchin, has gained attention in recent years due to its potential in biomedical research, particularly in the field of diabetes treatment. Researchers have identified certain protein extracts from this marine organism that exhibit significant anti-diabetic properties. The anti-diabetic potential of Stomopneustus variolaris is attributed to specific bioactive compounds found within its protein extracts. These compounds have been shown to modulate glucose metabolism, enhance insulin sensitivity, and regulate key enzymes involved in carbohydrate metabolism. Such properties make them promising candidates for the development of novel therapeutic agents for diabetes management.

Studies focusing on these protein extracts have demonstrated their ability to reduce blood glucose levels in experimental models. This effect is often comparable to or even more potent than conventional anti-diabetic medications. Moreover, the extracts have shown additional benefits such as antioxidant activity, which could help mitigate oxidative stress—a common complication associated with diabetes. The mechanism behind the anti-diabetic activity of Stomopneustus variolaris extracts involves interactions with cellular pathways that govern glucose uptake and utilization. By targeting these pathways, the extracts contribute to improved glucose homeostasis and overall metabolic health.

Furthermore, the use of marine organisms like Stomopneustus variolaris for bioactive compound discovery emphasizes the importance of biodiversity in drug development. Marine environments offer a vast and relatively unexplored resource of potential therapeutic agents, including those with anti-diabetic properties. Thus, the protein extracts from Stomopneustus variolaris show promising potential as effective anti-diabetic agents. Continued research into their mechanisms of action, safety profile, and clinical efficacy is crucial for advancing these extracts toward pharmaceutical development. Harnessing the bioactive compounds from marine organisms could pave the way for innovative treatments in diabetes care, offering new hope for patients managing this chronic condition.

 

Key Words: Stomopneustus, protein extracts, antidiabetic potential.

Email: shantiprabhay@gmail.com

 

Comparison of Physio-functional and Structural characterization

of Dual-modified tuber starches

Likhitha Yadav. Prakurthi, G. Sri Harika, Dr.Ch.Koteswara Reddy

Department of Food Science and Technology, GITAM (Deemed to be University)

 

ABSTRACT

There are few studies on the dual alteration of root starches, and none have looked at the combined action of acetic acid (AA) and ultrasonication. In the present work, elephant foot yam (EFY) starch, cassava (CS) starch, and sweet potato (SP) starch were exposed to various time periods of ultrasonication followed by acetylation, whereas native starches served as controls. Various properties, including functional, thermal, and morphological, were investigated. Both treatments enhanced starch's water and oil absorption. AA modification reduced thermal characteristics as US time increased. Starch morphology indicated aggregation of individual granules, resulting in surface alterations, pores, and cracks with AA+US. Acetic acid modification increases crystallinity. Changes in functional groups detected by FTIR analysis revealed a peak development (1710-1690 cm-1) related to AA modification. The results demonstrated that AA+US affected the functionality, morphology, and other structural properties of SP, EFY, and CS starches, enabling us to utilize the modified starch in various applications such as confectionery, bread, tablet binder, and encapsulation.

 

 

PREPARATION AND STANDARDIZATION OF MORINGA CANDY 

V DEVAKI NANDINI, P NIGAMA SAMHITHA , P JAHNAVI 

Yogi Vemana University, Kadapa

ABSTRACT

Moringa candy represents a novel confectionery product that leverages the nutritional benefits of Moringa oleifera, a plant known for its high content of vitamins, minerals, and antioxidants. V DEVAKI NANDINI, P NIGAMA SAMHITHA , P JAHNAVI developed this product under the mentorship of Dr. V RAMA KRISHNA and Dr. P ARUNA . This  explores the potential of moringa candy as a functional food, its health benefits, production process, and market potential.

Moringa oleifera, commonly known as the drumstick tree, is renowned for its nutrient-dense leaves, which contain significant levels of vitamin C, vitamin A, calcium, potassium, and protein. Incorporating moringa into candy can offer a convenient and palatable way to deliver these nutrients to a broad audience, including children and adults who may be reluctant to consume leafy greens.Moringa candy can provide various health benefits due to its rich nutritional profile. Regular consumption may help improve immune function, support bone health, enhance skin health, and provide antioxidant protection. Moreover, moringa’s anti-inflammatory properties can contribute to overall well-being.The production of moringa candy involves several steps, including the harvesting and drying of moringa leaves, powdering the dried leaves, and incorporating the powder into a candy base. The formulation must ensure that the nutritional integrity of moringa is maintained while achieving an acceptable taste and texture. Natural sweeteners and flavor enhancers can be used to improve palatability.

The market for health-oriented confectionery products is growing, driven by increasing consumer awareness of nutrition and wellness. Moringa candy can appeal to health-conscious consumers seeking convenient, nutrient-rich snacks. Effective marketing strategies highlighting the health benefits and natural ingredients can enhance product acceptance and market penetration.Moringa candy offers a promising opportunity to combine health benefits with consumer-friendly confectionery. By harnessing the nutritional power of moringa, this product can cater to the demand for functional foods and support better health outcomes. Further research and development are needed to optimize the formulation and production processes to ensure product quality and consumer satisfaction.

Author for correspondence- pasalurijahnavi@gmail.com

 

Detection And Identification of Pest By Using Artificial Intelligence

P.Hani¹ K. Jaya Sai Deepika²

   1- BSC. Agriculture ,St. Joseph’s College for Women(A)

                         2-Assistant Professor, Department of Entomology,St. Joseph’s College for women(A)

 

ABSTRACT

Farmers are facing unpredictable pest outbreaks due to climate change, increased international trade of infested materials, and challenges in pest control.  By taking into account factors like natural enemies, economic thresholds, plant susceptibility, pest biology Detection and Identification of pest is done with the help of Artificial Intelligence. With the help of Acoustic sensors, Ultrasonic sensors ,Optical sensors and Image processing System pest detection and identification is done . Expert staff are crucial in designing the system, monitoring ecological factors, and making decisions. AI can significantly enhance sustainable pest management by handling routine tasks such as monitoring biological and environmental components and determining the best times and methods for pest control.

Keywords:  Artificial Intelligence, Bio monitoring, Detection, Pest.

 Assistant for Correspondence

P.Hani

Student of BSC Agriculture

Email: pinnintihani156@gmail.com

 

 

 

Unveiling The Hidden Power House Soil Microbes And Their Impact On  Plant Health

B.Dishitha 1 D.Tejaswani

1- BSC. Agriculture ,St. Joseph’s College for Women(A)

                         2-Assistant Professor, Department of Agriculture,St. Joseph’s College for women(A)

  ABSTRACT

Soil is an essential, finite resource and Earth’s nutritional reservoir. Microbes drive biological transformations and manage carbon, macro, and micronutrient pools, facilitating soil and plant- microbe interactions. In this respect, it harbors very heterogeneous populations of  icroorganisms among which there are bacteria, archaea, and fungi. It is these microbes that enable sustainable agriculture by replacing fertilizers and pesticides with environmentally friendly versions. They enhance plant growth by providing the necessary nutrition, controlling pests in a natural way, and by stimulating root development.

Keywords: Macro and Micro nutrients, Plant Microbe interaction, Soil Micro Organisms, Soil

Health, Sustainable Agriculture.

 Author of Correspondence:

B Dishitha

Student of 3 rd BSC.AGRD

Mail ID: dishithadishitha28@gmail.com

 

 

 

Pest management by using Beauvaria bassiana as a Bio-control agent

                        Harshitha chinni, Jaya Sai Deepika2

   1- BSC. Agriculture ,St. Joseph’s College for Women(A)

                        2-Assistant Professor, Department of Entomology,St. Joseph’s College for women(A)

 ABSTRACT

Beauveria bassiana is an harshaentomopathogenic fungus .B.bassiana is widely recognized for its potential in biological pest control. It acts as an important bio control agent against insect pest. It has been isolated from an infected Bombyx mori,USA.It as been used as biocontrol agent due to its ability to infect and kill a wide range of insect hosts.B.bassiana is very ideal for homopteran pest.B. Bassiana develops a white muscardine later and infects insects through spore attachment, germination, cuticle penetration, and internal proliferation, ultimately leading to the insect’s death. It effectively targets aphids, whiteflies, beetles, caterpillars, grasshoppers, and termites, among others. The advantages of using B. bassiana include its eco-friendly nature, specificity to pests, and role in managing pesticide resistance. And its importance in agriculture for managing many pest growth.  Hereby, we can acknowledge the role of B.bassiana as a Bio-control control agent for managing different pest species ( mainly, homopteran pests) without affecting human health.

Key words: Beauveria bassiana,Bio-control agent,pest, management

 Author for correspondence

Miss Harshitha Chinni

Student of 3rd AGRD,

Contact number: 9110541836

Mail id: harshithachinni905@gmail.com

 

 

 

 

 

IRON CONTENT OF DEHYDRATED CAULIFLOWER LEAF POWDER FOR ANAEMIA

 

Vadarevu Sony¹ and Balasasirekha.R²

¹ Research Scholar, Department of Food Science and Nutrition, Avinashilingam Institute for

Home Science and Higher Education for Women, Coimbatore, Tamil Nadu, India

²Assistant Professor, Department of Food Science and Nutrition, Avinashilingam Institute for

Home Science and Higher Education for Women, Coimbatore, Tamil Nadu, India

¹

 

ABSTRACT

India is one of the countries which extensively produces cauliflowers in their states, Still, the population is deficient of micronutrients and causes serious health deficiencies. Cauliflower (Brassica oleracea) belongs to Brassicaceae family a Cruciferous seasonal vegetable, grows extensively, best available and consumed by all socio-economic group with reasonable price, but the most neglected part of cauliflower is the leaf, usually the leaf of the cauliflower is discarded as a waste and utilized for animal feed. The main objective of the present study is identifying the best method of drying technique of cauliflower leaf powder and to analyse its macronutrients and micronutrients. Cauliflower leaves were collected from local farmers and washed thoroughly with water and applied for different drying techniques which are sun, shade, roast, oven, cabinet drying to check the iron content. The results show high iron content is retained in roasted dry method with 30mg/g, and with lea moisture content of 5.7% and good amount of vitamin C 400mg/100gms. The research concludes cauliflower leaves is a good source of iron, calcium and beta carotene, which improves the health quality and prevent from anaemia, thus incorporation of value-added cauliflower leaves in food can prevent from deficiencies.

Keyword: Cauliflower Leaves Powder, Cabinet Drying, Deficiencies

 

email id : vadarevusony@gmail.com

 

"A COMPARATIVE STUDY ON PHYSIOCHEMICAL ATTRIBUTES AND PRODUCT DEVELOPMENT ON EXTRACTION OF PANEER FROM 5 DIFFERENT BOVINE MILK SAMPLE "

                              ¹Dr. T. Gayatri, ²B. Likita Sri, ³Vadarevu Sony

¹Assistant Professor, Department of Home Science, St Joseph’s College for Women (Autonomous), Visakhapatnam, Andhra Pradesh

medagayatri87@gmail.com

² Post Graduate, Food and Nutrition, St Joseph’s College for Women (Autonomous), Visakhapatnam, Andhra Pradesh

3 Assistant Professor, Department of Home Science, St Joseph’s College for Women (Autonomous), Visakhapatnam, Andhra Pradesh

Milk and paneer are excellent sources of protein, vitamins, and minerals. They contain an array of micro- and macronutrients, including amino acids, vitamin B12, calcium, magnesium, phosphorus, among others. In an ideal world, paneer would form a very significant part of our daily intake if taken in moderation and coupled with a healthy lifestyle. 

Paneer, being a complete protein and a probiotic, in its cooked form, aids easy digestion. In the present study, paneer extracted from five different bovine milk samples was used: buffalo milk, cow milk, organic milk, homogenized milk, and pasteurized milk.

 For this study, paneers were prepared and compared to each other based on the recipes developed through these recipes. The results developed food recipes were evaluated for their sensory attributes by a panel consisting of 10 members. The results were evaluated. 

Milk is a white aqueous solution and an emulsion or colloid of butterfat globules within a water-based fluid that contains dissolved carbohydrates and protein aggregates with minerals. It is produced as a food source for the young, providing energy, the biosynthesis of non-essential amino acids, essential fatty acids, vitamins and trace elements, and water. Paneer is a direct acid- and heat-coagulated cheese procured from milk using a coagulating agent. 

Paneer is one of the most common ingredients used in Indian cooking, more so in North India. In India, 1% of the total milk production is converted into paneer, with an estimated annual production of 150,000 tons.

In this paper, an attempt has been made to analyse and compare the yield and nutro-chemical parameters of paneer samples extracted from five different milk samples. In the present study, the milk samples selected were cow milk, buffalo milk, organic milk, homogenized milk, and pasteurized milk. 

Nutrient-chemical tests that were estimated included carbohydrates, proteins, fats, calcium, phosphorus, and total titratable acid. This comparative analysis shows that the maximum results of the tests in the present study concluded that the extraction of paneer from pasteurized milk showed a higher yield than the other milk samples, while buffalo milk paneer showed a higher content of nutrients in comparison to the remaining four paneer samples.

Keywords- Milk, Paneer, Yield & Nutro-Chemical parameters, Study 

 

 

 

 

 

 

 

 

Unveiling certain synthetic food colorants: Insights into their chemistry, uses and health implications

V. Prabhakar Rao^1*, P. Jeevan Jyothi², L. Md. Bhakshu³, B. L. Prasanna Latha⁴, T. Gunasekhar⁵

¹Lecturer in Chemistry, Dr. YSR Government Degree College, Vedurukuppam- 517569, Andhra Pradesh, India

²Principal, PVKN (A) College, Chittoor- 517001, Andhra Pradesh, India 

³Lecturer in Botany, Dr. YSR Government Degree College, Vedurukuppam-517569, Andhra Pradesh, India

⁴Lecturer in Zoology, Dr. YSR Government Degree College, Vedurukuppam-517569, Andhra Pradesh, India

⁵Lecturer in Chemistry, S. V. Arts College, Tirupati-517501, Andhra Pradesh, India

Corresponding author mail id: vipparlaprabhakararao@gmail.com

ABSTRACT

Food  colorant is any dye, pigment or substance that imparts color when it is added to food or beverages. They are added to make food more attractive, appealing, appetizing and informative. Synthetic food colorants in particular  offer several advantages when added to food, such as consistent coloring, stability under various processing conditions and cost-effectiveness compared to the natural colorants. They also allow for a broad spectrum of vibrant colors, which are crucial in maintaining product uniformity and meeting consumer expectations. However, the health effects of synthetic food colorants have been a significant concern. Studies have linked certain colorants to adverse health outcomes, including hyperactivity in children, allergic reactions and potential carcinogenicity. For instance, colorants like tartrazine (Yellow 5) and erythrosine (Red 3) have been associated with behavioral changes and thyroid tumors in animal studies. These concerns have led to stricter regulations and a growing demand for natural alternatives. Ongoing research is focused on understanding the long-term health impacts of synthetic colorants and developing safer, more sustainable alternatives. There is a need for further research to clarify the mechanisms by which these colorants affect health, particularly at low exposure levels and to explore the potential of natural colorants that can provide similar benefits without adverse effects .

Key words: Synthetic food colorants, carcinogenicity, hyperactivity, thyroid tumors.